ID: 1071242705

View in Genome Browser
Species Human (GRCh38)
Location 10:83725807-83725829
Sequence TGGGCTACTGAGGCTGAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071242701_1071242705 -1 Left 1071242701 10:83725785-83725807 CCGGTGGGCTAGGACAGGGAGTT No data
Right 1071242705 10:83725807-83725829 TGGGCTACTGAGGCTGAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071242705 Original CRISPR TGGGCTACTGAGGCTGAACA TGG Intergenic
No off target data available for this crispr