ID: 1071242706

View in Genome Browser
Species Human (GRCh38)
Location 10:83725808-83725830
Sequence GGGCTACTGAGGCTGAACAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071242701_1071242706 0 Left 1071242701 10:83725785-83725807 CCGGTGGGCTAGGACAGGGAGTT No data
Right 1071242706 10:83725808-83725830 GGGCTACTGAGGCTGAACATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071242706 Original CRISPR GGGCTACTGAGGCTGAACAT GGG Intergenic
No off target data available for this crispr