ID: 1071242707

View in Genome Browser
Species Human (GRCh38)
Location 10:83725812-83725834
Sequence TACTGAGGCTGAACATGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071242701_1071242707 4 Left 1071242701 10:83725785-83725807 CCGGTGGGCTAGGACAGGGAGTT No data
Right 1071242707 10:83725812-83725834 TACTGAGGCTGAACATGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071242707 Original CRISPR TACTGAGGCTGAACATGGGC AGG Intergenic
No off target data available for this crispr