ID: 1071248767

View in Genome Browser
Species Human (GRCh38)
Location 10:83793438-83793460
Sequence GAAAATGCAGGGATTCATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071248767_1071248771 1 Left 1071248767 10:83793438-83793460 CCCAGATGAATCCCTGCATTTTC No data
Right 1071248771 10:83793462-83793484 TCTAGTAGTTTTATAGTTTCAGG 0: 115
1: 614
2: 2039
3: 3700
4: 6409

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071248767 Original CRISPR GAAAATGCAGGGATTCATCT GGG (reversed) Intergenic
No off target data available for this crispr