ID: 1071251949

View in Genome Browser
Species Human (GRCh38)
Location 10:83827579-83827601
Sequence GGCCTTCGGCCACAGAGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071251945_1071251949 1 Left 1071251945 10:83827555-83827577 CCAATGGTTTGCCAAGGGCTCTC No data
Right 1071251949 10:83827579-83827601 GGCCTTCGGCCACAGAGTGAAGG No data
1071251942_1071251949 8 Left 1071251942 10:83827548-83827570 CCTTACACCAATGGTTTGCCAAG No data
Right 1071251949 10:83827579-83827601 GGCCTTCGGCCACAGAGTGAAGG No data
1071251948_1071251949 -10 Left 1071251948 10:83827566-83827588 CCAAGGGCTCTCAGGCCTTCGGC No data
Right 1071251949 10:83827579-83827601 GGCCTTCGGCCACAGAGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071251949 Original CRISPR GGCCTTCGGCCACAGAGTGA AGG Intergenic
No off target data available for this crispr