ID: 1071252805

View in Genome Browser
Species Human (GRCh38)
Location 10:83838184-83838206
Sequence CCACCCTACTGCAATAAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071252800_1071252805 -2 Left 1071252800 10:83838163-83838185 CCTGGGCCCTCCTAGTTTACTCC No data
Right 1071252805 10:83838184-83838206 CCACCCTACTGCAATAAAATAGG No data
1071252794_1071252805 28 Left 1071252794 10:83838133-83838155 CCCCATCAGAAGTCAGGTCGGGT No data
Right 1071252805 10:83838184-83838206 CCACCCTACTGCAATAAAATAGG No data
1071252796_1071252805 26 Left 1071252796 10:83838135-83838157 CCATCAGAAGTCAGGTCGGGTTC No data
Right 1071252805 10:83838184-83838206 CCACCCTACTGCAATAAAATAGG No data
1071252795_1071252805 27 Left 1071252795 10:83838134-83838156 CCCATCAGAAGTCAGGTCGGGTT No data
Right 1071252805 10:83838184-83838206 CCACCCTACTGCAATAAAATAGG No data
1071252801_1071252805 -8 Left 1071252801 10:83838169-83838191 CCCTCCTAGTTTACTCCACCCTA No data
Right 1071252805 10:83838184-83838206 CCACCCTACTGCAATAAAATAGG No data
1071252792_1071252805 29 Left 1071252792 10:83838132-83838154 CCCCCATCAGAAGTCAGGTCGGG No data
Right 1071252805 10:83838184-83838206 CCACCCTACTGCAATAAAATAGG No data
1071252799_1071252805 4 Left 1071252799 10:83838157-83838179 CCAAGTCCTGGGCCCTCCTAGTT No data
Right 1071252805 10:83838184-83838206 CCACCCTACTGCAATAAAATAGG No data
1071252802_1071252805 -9 Left 1071252802 10:83838170-83838192 CCTCCTAGTTTACTCCACCCTAC No data
Right 1071252805 10:83838184-83838206 CCACCCTACTGCAATAAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071252805 Original CRISPR CCACCCTACTGCAATAAAAT AGG Intergenic
No off target data available for this crispr