ID: 1071254502

View in Genome Browser
Species Human (GRCh38)
Location 10:83858213-83858235
Sequence ATATGTACTCTGCCATTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071254493_1071254502 30 Left 1071254493 10:83858160-83858182 CCATGGCCCAGATACATTGATCT No data
Right 1071254502 10:83858213-83858235 ATATGTACTCTGCCATTTGGGGG No data
1071254494_1071254502 24 Left 1071254494 10:83858166-83858188 CCCAGATACATTGATCTATTAAA No data
Right 1071254502 10:83858213-83858235 ATATGTACTCTGCCATTTGGGGG No data
1071254495_1071254502 23 Left 1071254495 10:83858167-83858189 CCAGATACATTGATCTATTAAAT No data
Right 1071254502 10:83858213-83858235 ATATGTACTCTGCCATTTGGGGG No data
1071254497_1071254502 -3 Left 1071254497 10:83858193-83858215 CCATCACAGACCGGTTAAGAATA No data
Right 1071254502 10:83858213-83858235 ATATGTACTCTGCCATTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071254502 Original CRISPR ATATGTACTCTGCCATTTGG GGG Intergenic
No off target data available for this crispr