ID: 1071254856

View in Genome Browser
Species Human (GRCh38)
Location 10:83862912-83862934
Sequence TCATCTCCATGACTTCCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071254856_1071254858 26 Left 1071254856 10:83862912-83862934 CCATCAGGAAGTCATGGAGATGA No data
Right 1071254858 10:83862961-83862983 AATTATACACACCCTAGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071254856 Original CRISPR TCATCTCCATGACTTCCTGA TGG (reversed) Intergenic