ID: 1071263173

View in Genome Browser
Species Human (GRCh38)
Location 10:83939556-83939578
Sequence TCCATGCCATTTAAGATCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071263171_1071263173 3 Left 1071263171 10:83939530-83939552 CCTAGAGGATAGCATTCAGACTC No data
Right 1071263173 10:83939556-83939578 TCCATGCCATTTAAGATCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071263173 Original CRISPR TCCATGCCATTTAAGATCTA TGG Intergenic
No off target data available for this crispr