ID: 1071263266

View in Genome Browser
Species Human (GRCh38)
Location 10:83940376-83940398
Sequence ATCCAGATCTCTAGGTCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071263266_1071263273 14 Left 1071263266 10:83940376-83940398 CCCTCTGACCTAGAGATCTGGAT No data
Right 1071263273 10:83940413-83940435 AGTAGCCAAGAGAATTTGCTGGG No data
1071263266_1071263274 15 Left 1071263266 10:83940376-83940398 CCCTCTGACCTAGAGATCTGGAT No data
Right 1071263274 10:83940414-83940436 GTAGCCAAGAGAATTTGCTGGGG No data
1071263266_1071263272 13 Left 1071263266 10:83940376-83940398 CCCTCTGACCTAGAGATCTGGAT No data
Right 1071263272 10:83940412-83940434 GAGTAGCCAAGAGAATTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071263266 Original CRISPR ATCCAGATCTCTAGGTCAGA GGG (reversed) Intergenic
No off target data available for this crispr