ID: 1071264219

View in Genome Browser
Species Human (GRCh38)
Location 10:83949856-83949878
Sequence ACTCACAGGCAGAAGGTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071264219_1071264227 9 Left 1071264219 10:83949856-83949878 CCCTTCACCTTCTGCCTGTGAGT No data
Right 1071264227 10:83949888-83949910 CCAAGGCCCTCATCAGATGCCGG No data
1071264219_1071264224 -8 Left 1071264219 10:83949856-83949878 CCCTTCACCTTCTGCCTGTGAGT No data
Right 1071264224 10:83949871-83949893 CTGTGAGTGGAAGCAGCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071264219 Original CRISPR ACTCACAGGCAGAAGGTGAA GGG (reversed) Intergenic
No off target data available for this crispr