ID: 1071264497

View in Genome Browser
Species Human (GRCh38)
Location 10:83952873-83952895
Sequence AAGAGTGAGAAGAGGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071264490_1071264497 7 Left 1071264490 10:83952843-83952865 CCAAAAGAATGAACTGTCTTGGG No data
Right 1071264497 10:83952873-83952895 AAGAGTGAGAAGAGGGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071264497 Original CRISPR AAGAGTGAGAAGAGGGAAGA GGG Intergenic
No off target data available for this crispr