ID: 1071265064

View in Genome Browser
Species Human (GRCh38)
Location 10:83957700-83957722
Sequence GGCTTGTGTTTGTGCAAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071265063_1071265064 -8 Left 1071265063 10:83957685-83957707 CCTGGTTTAATTAATGGCTTGTG No data
Right 1071265064 10:83957700-83957722 GGCTTGTGTTTGTGCAAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071265064 Original CRISPR GGCTTGTGTTTGTGCAAGAG AGG Intergenic
No off target data available for this crispr