ID: 1071267084

View in Genome Browser
Species Human (GRCh38)
Location 10:83973966-83973988
Sequence GACAGCCCTTGGCCTGTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071267084_1071267087 11 Left 1071267084 10:83973966-83973988 CCAGTAACAGGCCAAGGGCTGTC No data
Right 1071267087 10:83974000-83974022 GAGTAGTTATCTGCAGAAGATGG 0: 178
1: 192
2: 102
3: 110
4: 247
1071267084_1071267088 15 Left 1071267084 10:83973966-83973988 CCAGTAACAGGCCAAGGGCTGTC No data
Right 1071267088 10:83974004-83974026 AGTTATCTGCAGAAGATGGCAGG 0: 185
1: 187
2: 104
3: 111
4: 225
1071267084_1071267089 16 Left 1071267084 10:83973966-83973988 CCAGTAACAGGCCAAGGGCTGTC No data
Right 1071267089 10:83974005-83974027 GTTATCTGCAGAAGATGGCAGGG 0: 180
1: 172
2: 120
3: 86
4: 284

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071267084 Original CRISPR GACAGCCCTTGGCCTGTTAC TGG (reversed) Intergenic
No off target data available for this crispr