ID: 1071267244

View in Genome Browser
Species Human (GRCh38)
Location 10:83975179-83975201
Sequence AGGATGAGTCCAGGACCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071267237_1071267244 12 Left 1071267237 10:83975144-83975166 CCAATTATTAATTCTGGCACTGG No data
Right 1071267244 10:83975179-83975201 AGGATGAGTCCAGGACCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071267244 Original CRISPR AGGATGAGTCCAGGACCCAC TGG Intergenic
No off target data available for this crispr