ID: 1071273839

View in Genome Browser
Species Human (GRCh38)
Location 10:84034712-84034734
Sequence GGTCTTCTTTCCAGGGGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071273839_1071273848 22 Left 1071273839 10:84034712-84034734 CCAGGTCCCCTGGAAAGAAGACC No data
Right 1071273848 10:84034757-84034779 TAAGGTGGCCCAGTGCTCCCAGG No data
1071273839_1071273845 7 Left 1071273839 10:84034712-84034734 CCAGGTCCCCTGGAAAGAAGACC No data
Right 1071273845 10:84034742-84034764 GCCAACTGCATGTCCTAAGGTGG No data
1071273839_1071273849 23 Left 1071273839 10:84034712-84034734 CCAGGTCCCCTGGAAAGAAGACC No data
Right 1071273849 10:84034758-84034780 AAGGTGGCCCAGTGCTCCCAGGG No data
1071273839_1071273844 4 Left 1071273839 10:84034712-84034734 CCAGGTCCCCTGGAAAGAAGACC No data
Right 1071273844 10:84034739-84034761 TCAGCCAACTGCATGTCCTAAGG No data
1071273839_1071273850 29 Left 1071273839 10:84034712-84034734 CCAGGTCCCCTGGAAAGAAGACC No data
Right 1071273850 10:84034764-84034786 GCCCAGTGCTCCCAGGGAACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071273839 Original CRISPR GGTCTTCTTTCCAGGGGACC TGG (reversed) Intergenic
No off target data available for this crispr