ID: 1071275234

View in Genome Browser
Species Human (GRCh38)
Location 10:84048296-84048318
Sequence ACTGAAGGGGAGGCAAGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071275234_1071275247 27 Left 1071275234 10:84048296-84048318 CCCACTCTTGCCTCCCCTTCAGT No data
Right 1071275247 10:84048346-84048368 CACTCAACTCAGTAGCCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071275234 Original CRISPR ACTGAAGGGGAGGCAAGAGT GGG (reversed) Intergenic
No off target data available for this crispr