ID: 1071275351

View in Genome Browser
Species Human (GRCh38)
Location 10:84049103-84049125
Sequence CAGTGGGGGTGGAGGGTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071275338_1071275351 24 Left 1071275338 10:84049056-84049078 CCTCAGTTTCCGTAAAGGGGTAG No data
Right 1071275351 10:84049103-84049125 CAGTGGGGGTGGAGGGTAGAAGG No data
1071275341_1071275351 15 Left 1071275341 10:84049065-84049087 CCGTAAAGGGGTAGGTGGTGTTT No data
Right 1071275351 10:84049103-84049125 CAGTGGGGGTGGAGGGTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071275351 Original CRISPR CAGTGGGGGTGGAGGGTAGA AGG Intergenic
No off target data available for this crispr