ID: 1071275702

View in Genome Browser
Species Human (GRCh38)
Location 10:84053121-84053143
Sequence CCCAGCTGCTTGGGAGATAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071275695_1071275702 13 Left 1071275695 10:84053085-84053107 CCCATATAATTGGCTGCACTGCC No data
Right 1071275702 10:84053121-84053143 CCCAGCTGCTTGGGAGATAGAGG No data
1071275697_1071275702 -8 Left 1071275697 10:84053106-84053128 CCATGTGCCTGTAGTCCCAGCTG No data
Right 1071275702 10:84053121-84053143 CCCAGCTGCTTGGGAGATAGAGG No data
1071275696_1071275702 12 Left 1071275696 10:84053086-84053108 CCATATAATTGGCTGCACTGCCA No data
Right 1071275702 10:84053121-84053143 CCCAGCTGCTTGGGAGATAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071275702 Original CRISPR CCCAGCTGCTTGGGAGATAG AGG Intergenic
No off target data available for this crispr