ID: 1071280085

View in Genome Browser
Species Human (GRCh38)
Location 10:84093714-84093736
Sequence CTGTGTCAGCCCCAAGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071280080_1071280085 6 Left 1071280080 10:84093685-84093707 CCTCAAAGTCCTGGGTTCAAGAG No data
Right 1071280085 10:84093714-84093736 CTGTGTCAGCCCCAAGTGGCTGG No data
1071280081_1071280085 -3 Left 1071280081 10:84093694-84093716 CCTGGGTTCAAGAGATCCTCCTG 0: 105
1: 6286
2: 99012
3: 196500
4: 262631
Right 1071280085 10:84093714-84093736 CTGTGTCAGCCCCAAGTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071280085 Original CRISPR CTGTGTCAGCCCCAAGTGGC TGG Intergenic
No off target data available for this crispr