ID: 1071283033

View in Genome Browser
Species Human (GRCh38)
Location 10:84120097-84120119
Sequence CCTGAAGTCTGGCACCCCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071283033_1071283037 -1 Left 1071283033 10:84120097-84120119 CCCGCGGGGTGCCAGACTTCAGG No data
Right 1071283037 10:84120119-84120141 GATATAGCAGAGAGAGAGCTTGG 0: 37
1: 26
2: 32
3: 36
4: 309
1071283033_1071283038 18 Left 1071283033 10:84120097-84120119 CCCGCGGGGTGCCAGACTTCAGG No data
Right 1071283038 10:84120138-84120160 TTGGCATGACTTATTACTCCAGG 0: 54
1: 49
2: 34
3: 47
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071283033 Original CRISPR CCTGAAGTCTGGCACCCCGC GGG (reversed) Intergenic
No off target data available for this crispr