ID: 1071283283

View in Genome Browser
Species Human (GRCh38)
Location 10:84122616-84122638
Sequence GGAGAAACTCCCTTCAGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071283283_1071283290 29 Left 1071283283 10:84122616-84122638 CCTGTCCTGAAGGGAGTTTCTCC No data
Right 1071283290 10:84122668-84122690 TAATTAAGATTTAGATCCCCTGG No data
1071283283_1071283291 30 Left 1071283283 10:84122616-84122638 CCTGTCCTGAAGGGAGTTTCTCC No data
Right 1071283291 10:84122669-84122691 AATTAAGATTTAGATCCCCTGGG No data
1071283283_1071283288 2 Left 1071283283 10:84122616-84122638 CCTGTCCTGAAGGGAGTTTCTCC No data
Right 1071283288 10:84122641-84122663 GGTCTGGTCAGACCTTTGTATGG 0: 40
1: 82
2: 96
3: 77
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071283283 Original CRISPR GGAGAAACTCCCTTCAGGAC AGG (reversed) Intergenic
No off target data available for this crispr