ID: 1071283285

View in Genome Browser
Species Human (GRCh38)
Location 10:84122621-84122643
Sequence ACCTAGGAGAAACTCCCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071283285_1071283288 -3 Left 1071283285 10:84122621-84122643 CCTGAAGGGAGTTTCTCCTAGGT No data
Right 1071283288 10:84122641-84122663 GGTCTGGTCAGACCTTTGTATGG 0: 40
1: 82
2: 96
3: 77
4: 128
1071283285_1071283292 30 Left 1071283285 10:84122621-84122643 CCTGAAGGGAGTTTCTCCTAGGT No data
Right 1071283292 10:84122674-84122696 AGATTTAGATCCCCTGGGCCTGG No data
1071283285_1071283291 25 Left 1071283285 10:84122621-84122643 CCTGAAGGGAGTTTCTCCTAGGT No data
Right 1071283291 10:84122669-84122691 AATTAAGATTTAGATCCCCTGGG No data
1071283285_1071283290 24 Left 1071283285 10:84122621-84122643 CCTGAAGGGAGTTTCTCCTAGGT No data
Right 1071283290 10:84122668-84122690 TAATTAAGATTTAGATCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071283285 Original CRISPR ACCTAGGAGAAACTCCCTTC AGG (reversed) Intergenic
No off target data available for this crispr