ID: 1071283287

View in Genome Browser
Species Human (GRCh38)
Location 10:84122637-84122659
Sequence ACAAAGGTCTGACCAGACCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 440
Summary {0: 36, 1: 91, 2: 103, 3: 63, 4: 147}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071283287_1071283290 8 Left 1071283287 10:84122637-84122659 CCTAGGTCTGGTCAGACCTTTGT 0: 36
1: 91
2: 103
3: 63
4: 147
Right 1071283290 10:84122668-84122690 TAATTAAGATTTAGATCCCCTGG No data
1071283287_1071283291 9 Left 1071283287 10:84122637-84122659 CCTAGGTCTGGTCAGACCTTTGT 0: 36
1: 91
2: 103
3: 63
4: 147
Right 1071283291 10:84122669-84122691 AATTAAGATTTAGATCCCCTGGG No data
1071283287_1071283292 14 Left 1071283287 10:84122637-84122659 CCTAGGTCTGGTCAGACCTTTGT 0: 36
1: 91
2: 103
3: 63
4: 147
Right 1071283292 10:84122674-84122696 AGATTTAGATCCCCTGGGCCTGG No data
1071283287_1071283293 22 Left 1071283287 10:84122637-84122659 CCTAGGTCTGGTCAGACCTTTGT 0: 36
1: 91
2: 103
3: 63
4: 147
Right 1071283293 10:84122682-84122704 ATCCCCTGGGCCTGGTGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071283287 Original CRISPR ACAAAGGTCTGACCAGACCT AGG (reversed) Intergenic
900690945 1:3980038-3980060 ACGCAGGTCAGACCAGACTTTGG - Intergenic
900782931 1:4629566-4629588 TAAAAGGTCAGACTAGACCTTGG + Intergenic
901946612 1:12709289-12709311 ACAAAGGTTCAACCAGACTTAGG - Intergenic
902031930 1:13429249-13429271 ACAAAGGTCCGACCAGATCTAGG + Intergenic
902051808 1:13569096-13569118 ACAAAGGTCCGACCAGACCTAGG + Intergenic
903473351 1:23602773-23602795 ACCAAGGTCTGGCCAGACCTGGG + Intronic
903473352 1:23602774-23602796 TCCCAGGTCTGGCCAGACCTTGG - Intronic
904571292 1:31467758-31467780 ACAAAGGTCTGACCAGACCTAGG - Intergenic
904713126 1:32446655-32446677 ACAAAGGCCCTACCAGACCTAGG - Intergenic
905335457 1:37241556-37241578 ACACAGGTCAGACCACACATCGG + Intergenic
905567782 1:38979608-38979630 ACAAAAGTCCAACCAGATCTAGG - Intergenic
906507577 1:46391643-46391665 ACAAAGGTCCGACCAGACCTAGG - Intergenic
906582484 1:46947596-46947618 ACGAAGGTCCAACCAGACCTAGG + Intergenic
906583252 1:46953776-46953798 ACAAAGGTTCAACCACACCTAGG + Intergenic
906601129 1:47130273-47130295 ACAAAGGCCCAACCAGATCTAGG - Intergenic
907391229 1:54159927-54159949 ACAGAGGTCTGGGCTGACCTGGG + Intronic
907505829 1:54917530-54917552 ACAAAGGTCCAACCAGACCTAGG - Intergenic
907602683 1:55786636-55786658 ACAAAGGTCCAACCAGACTTAGG - Intergenic
908300889 1:62760156-62760178 ACAAAGGTCCAACCAGCTCTAGG + Intergenic
908512395 1:64859940-64859962 AGGAAGGCCTGACCAGAGCTTGG + Intronic
910590739 1:88926287-88926309 ACAAAGGTCCGACCAGACCTAGG + Intergenic
910808248 1:91210263-91210285 ACAAAGGTTGGACCAGACCTAGG - Intergenic
911299191 1:96152024-96152046 GCAAAGGTCTGACCAGACCTAGG + Intergenic
911372896 1:97015310-97015332 ACAAAAGTCAGGCCACACCTGGG - Intergenic
911507849 1:98775706-98775728 ACAAAAGACTGACTTGACCTGGG + Intergenic
912272715 1:108227313-108227335 ACAGAGGTGAGACCAGACATAGG + Intronic
912295505 1:108467009-108467031 ACAGAGGTGAGACCAGACATAGG - Intronic
913713721 1:121512658-121512680 ACAAAGGTCCTATCAGACCTAGG + Intergenic
916084138 1:161256235-161256257 ACAAAGGTCTAACCAGACCTAGG + Intergenic
916749413 1:167710882-167710904 AGAAACATCTGACCAGAACTAGG + Intergenic
916987737 1:170209202-170209224 ACAAAGGACTCAGCAGTCCTTGG + Intergenic
917227797 1:172802511-172802533 ACAAAGGTCCAACCAGATCTAGG + Intergenic
917307211 1:173638885-173638907 ACAAAAGTCAGGCCAGATCTAGG + Intronic
917311936 1:173687889-173687911 ACAAAGGTCCGACCAGACCTAGG - Intergenic
917676588 1:177324438-177324460 ACGAAGGTCCGACCAGACCTAGG + Intergenic
918798103 1:188931915-188931937 ATAAAGGTTTGCCCAGTCCTAGG - Intergenic
919257255 1:195140574-195140596 ACAAGGGTCTGACCAGATCTAGG + Intergenic
919559173 1:199096343-199096365 ACAAAGGTCCGACCAGACCTAGG + Intergenic
920425374 1:205870858-205870880 ACAAAGGTCCGACCAGACCTAGG - Intergenic
920633722 1:207678451-207678473 ACAAAGGTATGACAAGATCAGGG + Intronic
920827577 1:209435928-209435950 ACACAGGTCTCTCTAGACCTGGG - Intergenic
921086048 1:211793726-211793748 TCAAAGGTATGACCATAGCTGGG - Intronic
922719325 1:227892322-227892344 ACAAAGGTCCACCCAGCCCTGGG - Intergenic
924859219 1:247904158-247904180 ACGAAGGTCTGACCAAACCTAGG - Intergenic
1063415167 10:5867256-5867278 ACAAAGGTCCAACCAGACCTAGG + Intronic
1064603086 10:17012900-17012922 ACAAAGGTCCCACCAGACATAGG - Intronic
1065082895 10:22144759-22144781 ACAAAGGTCTGACCAGACCCAGG + Intergenic
1065810342 10:29437402-29437424 ACAAAGGTCCAACCAAACCTAGG - Intergenic
1065930853 10:30477348-30477370 ACAAAGGTCCAACCAAACCTAGG + Intergenic
1067437389 10:46287628-46287650 ACTTTGGTCAGACCAGACCTAGG + Intronic
1068240884 10:54299629-54299651 ACAAAGGTCTGACCAGATCTAGG + Intronic
1068791991 10:61039049-61039071 ACAAAGGTCTGACCAGACCTAGG - Intergenic
1069292112 10:66792824-66792846 TCAAACTTCTGTCCAGACCTAGG - Intronic
1069364746 10:67685489-67685511 ACAAAGGTCCAACCAGACCTAGG - Intronic
1069939089 10:71941569-71941591 ACAAAGGTCCGACCAGACCTAGG + Intergenic
1070992352 10:80743570-80743592 ATAAAAGTTTGACCAGACTTAGG + Intergenic
1071283287 10:84122637-84122659 ACAAAGGTCTGACCAGACCTAGG - Intergenic
1071327174 10:84529020-84529042 TCAAAGGTCTGACCAGACCTAGG - Intergenic
1071835208 10:89411214-89411236 ACAAAGGTCTGACCAGATCTAGG + Intronic
1072067115 10:91881840-91881862 AAAAAGTCCTCACCAGACCTCGG + Intergenic
1072378334 10:94839822-94839844 ACAACAGTCCGACCAGACATAGG - Intronic
1072472137 10:95722754-95722776 ACAAAGGTCCGACCAGACCTAGG - Intronic
1072696968 10:97611118-97611140 ACGCAGGTCACACCAGACCTGGG - Intronic
1074488766 10:113918455-113918477 ACAATGGTCTGTCCATACCATGG + Intergenic
1074742428 10:116498234-116498256 ACAAAGGTCTGACCAGACCTAGG - Intergenic
1075146801 10:119889308-119889330 ACAAAGGTCCAACCAGATCTAGG + Intronic
1075632152 10:124006807-124006829 AGGAAGGTCTGCCCAGAACTGGG + Intergenic
1075700228 10:124464498-124464520 ACAAAGGGCAGCCCAGACCTAGG + Intronic
1075908901 10:126106443-126106465 ATAAAGGCCTGACCTGACCCAGG - Intronic
1079239482 11:18712453-18712475 CCAAAGGTCTGCCCAGACTAGGG + Intronic
1079255034 11:18820402-18820424 ACAAAGGTCTAACCAGACCTAGG - Intergenic
1079370249 11:19846391-19846413 ACAGAGGTCTTTTCAGACCTGGG + Intronic
1080943886 11:36949702-36949724 ACACAGGGCTGAGCAGATCTGGG - Intergenic
1081033661 11:38115519-38115541 ACAAAGATCTGACCAGACCTAGG + Intergenic
1081070404 11:38603556-38603578 ACAAAGTTTTGACCAGACCTAGG + Intergenic
1081146355 11:39565621-39565643 ACAAATGTCCAACCAGACCCAGG + Intergenic
1083089739 11:60187355-60187377 ACAAAGGTCTGACCAGACCTAGG + Intergenic
1084118520 11:67055773-67055795 ACAAGGGTCTTCCCAGATCTTGG - Intergenic
1085228764 11:74946714-74946736 ACCCAGGCCTGACCTGACCTTGG - Intronic
1085239643 11:75041994-75042016 ACAAAGGTCCGAACAGATGTAGG + Intergenic
1086081570 11:82908328-82908350 ACAATGGTCTGTGCAGCCCTGGG - Intronic
1086317883 11:85612317-85612339 ACGAAGGTCTGACCAGACCTAGG + Intronic
1086973587 11:93108951-93108973 ACAAAGGTCCCACCAGACCTAGG - Intergenic
1086987285 11:93264067-93264089 ACAATGGTCCAACTAGACCTAGG + Intergenic
1087458777 11:98420963-98420985 GCAAAGGTCTGACCGGACCTAGG - Intergenic
1087894660 11:103573956-103573978 ACAAAGGTCCAACCAGACCTAGG + Intergenic
1089235790 11:117023972-117023994 ACAAAAGTCTGTCCAGGCCCGGG - Intronic
1089768288 11:120784456-120784478 CCAGAGGTCTGACCACACCAAGG - Intronic
1090237663 11:125161192-125161214 ACAAAGGTTGGATCACACCTTGG - Intergenic
1090323892 11:125868348-125868370 ACAAAAGTCTGACCAGACCTAGG - Intergenic
1091217122 11:133908958-133908980 ACAAAGGTCTGGGCCGCCCTTGG + Exonic
1092469686 12:8766719-8766741 ACAAAGGTCTGACCAGACCTAGG - Intronic
1093356571 12:18174473-18174495 ACAAAGGTCCAGCCAGACATAGG + Intronic
1093594283 12:20942994-20943016 ACAAAGGTCTAACCAGACCTAGG - Intergenic
1094319526 12:29170292-29170314 ACAAAGGTCTGACCAGACCAAGG - Intronic
1095138812 12:38638312-38638334 ACAAAGGTCCAACAAGACCTAGG + Intergenic
1095283738 12:40385918-40385940 GCAAAGGTCCGACCAGACCTAGG + Intergenic
1096352309 12:50910530-50910552 ACAAAGGTCCGGCCAGACCTAGG - Intergenic
1096517468 12:52165085-52165107 GCACAGGGCTGACCAGAACTGGG + Intergenic
1098248249 12:68542205-68542227 ACAAAGGTCCAACCAGACCTAGG + Intergenic
1100014626 12:89994120-89994142 CCAGAGTTTTGACCAGACCTGGG + Intergenic
1100050657 12:90445063-90445085 ACAAAGGTCTGACCAGATCTAGG - Intergenic
1101514241 12:105419710-105419732 ACAAAGCTTTGGGCAGACCTAGG - Intergenic
1102606154 12:114068976-114068998 ACAAAGGTTTGACCAGGCATAGG + Intergenic
1103977049 12:124709780-124709802 ACACAGCTCTAACCAGTCCTGGG + Intergenic
1104851718 12:131878823-131878845 ACTAAGGTCCGACCAGACCTAGG - Intergenic
1108515836 13:51201698-51201720 ACGAAGGTCCGACCAGATCTAGG - Intergenic
1108849081 13:54706023-54706045 ACAAAGGTCCTACCAGACCTGGG + Intergenic
1108876446 13:55055755-55055777 ACAAAGGTCTGACCAGACCTAGG + Intergenic
1109606889 13:64707766-64707788 ACAAAAGTCCGACCAGACCTAGG - Intergenic
1109909670 13:68892831-68892853 ACAAAGGTTGGACCAGACCTAGG - Intergenic
1109931533 13:69223607-69223629 ACGAAGGTCCGACCAGACCTAGG + Intergenic
1111021686 13:82459281-82459303 ACGAAGGTCCGAGCAGACCTAGG + Intergenic
1111806014 13:93041300-93041322 ACAAAGGTCCAACCAGAACTGGG + Intergenic
1114009977 14:18356337-18356359 ACAAAGGTCTGACAAGACCTAGG + Intergenic
1114236267 14:20826792-20826814 ACAAAGGTCTGACCAGACCTAGG - Intergenic
1114384089 14:22238387-22238409 ACAAAGGTCCGACCAGACCTAGG + Intergenic
1115211089 14:30967859-30967881 ACAAAGATCCGACCAGACCTAGG + Intronic
1115285109 14:31707127-31707149 ACAAAGGTCCGACCAGATCTAGG - Intronic
1116725701 14:48559163-48559185 ACAAAGGTCCAACCAGACCTAGG + Intergenic
1116901493 14:50366288-50366310 GTAAAGGTCTGACCAAACCAAGG + Intronic
1117179714 14:53179838-53179860 ACAAAGGTCCAACCAGACCTAGG - Intergenic
1117955376 14:61119318-61119340 CCAAAGGTCTGACTAGACCTAGG - Intergenic
1121983055 14:98471604-98471626 ACAAATGTCTGAAAAAACCTTGG + Intergenic
1122382520 14:101318921-101318943 ACAAAGGTATGACCAGACCTAGG + Intergenic
1125690097 15:41589071-41589093 ACAAAGGTTCGACCAGACCTAGG + Intergenic
1126778074 15:52116812-52116834 ACAAAGGTCACACCAGTCCGAGG - Exonic
1128362861 15:66974817-66974839 ACAAAGATCCGACCAGACCTAGG - Intergenic
1129056903 15:72826588-72826610 AGAAAGGCCTTACCAGCCCTAGG - Intergenic
1133381716 16:5336525-5336547 CCACAGGTCTGACCATACCTAGG - Intergenic
1133957976 16:10463588-10463610 CCAAAGGTCTGACCAGGGCTGGG - Intronic
1133960651 16:10490060-10490082 ACAAAGATCTGACCAGACCTAGG + Intergenic
1135224561 16:20644463-20644485 ACAGAGGACCGACAAGACCTAGG + Intronic
1135339169 16:21631636-21631658 ACAAAGGTCCAATCAGACATAGG - Intronic
1137041733 16:35619376-35619398 ACAAAGGTATGACCAGACCTAGG - Intergenic
1137955603 16:52825769-52825791 GCAAAGCTCAGACCTGACCTAGG + Intergenic
1138860407 16:60749504-60749526 ACAAGGATATGACCAGAACTGGG + Intergenic
1146764004 17:35502523-35502545 ACAAAGGTCCGACCAGACCTAGG + Intronic
1148805845 17:50263639-50263661 ACATAGGTCTGAACTGTCCTGGG + Intergenic
1148829110 17:50418527-50418549 ACAAAGGTCCAACCAGACCTAGG - Intergenic
1149274316 17:55016685-55016707 ACAAAGGACCAACCAGACCTAGG - Intronic
1151723361 17:75870785-75870807 ACAATGCTCTGAGAAGACCTAGG - Intergenic
1152453551 17:80399219-80399241 ACAAAGGCCCTACCATACCTAGG + Intergenic
1153401014 18:4683782-4683804 ACAAAGGTCTGACCAGACCTAGG + Intergenic
1153438281 18:5089485-5089507 ACAAAGGTCTGACCAGACCAAGG + Intergenic
1153826564 18:8880690-8880712 ACAAAGGTCTGACCAGACCTAGG - Intergenic
1153830244 18:8915567-8915589 ACAAAAGTCTGACCAGACCTAGG + Intergenic
1153962167 18:10149067-10149089 AAAAAGGTCTGTGCAGCCCTGGG - Intergenic
1154527849 18:15311536-15311558 ACAAAGGTCTGACCAGACCTAGG - Intergenic
1155154160 18:23144215-23144237 ATCAAGCTCTGACCAGACCACGG - Intronic
1155420721 18:25652697-25652719 ACAAGGCTCTGTCCAAACCTAGG - Intergenic
1155746356 18:29360492-29360514 ACAAAAGTTCAACCAGACCTAGG - Intergenic
1158012079 18:52740575-52740597 ACAAAGGTCTGACAGGTCCAGGG - Intronic
1158498033 18:57974242-57974264 GCAAGGGTCTCACCAGCCCTTGG - Intergenic
1161830407 19:6598771-6598793 ACGAACGTCTGACCAGACGTAGG + Intronic
1162108379 19:8385258-8385280 ACAAAGGTCTGACCAGATCTAGG + Intronic
1162268035 19:9592131-9592153 AGAAAGGTTCGACCAGACCTAGG - Intergenic
1162608780 19:11732984-11733006 CCTAAGGTCTGACAAGAGCTGGG + Intronic
1163867239 19:19784314-19784336 ACAAAGGTCCGACCAGACCTAGG - Intergenic
1163900909 19:20099478-20099500 ACAAAAGTCTGAGCTGACCTAGG - Intronic
1163912218 19:20206393-20206415 ACAAAAGTTCGACCAGACTTAGG + Intergenic
1163929157 19:20372111-20372133 AGAAAAGTCTGACCAGACCTAGG + Intergenic
1163991657 19:21004238-21004260 ACAAAGGTCTGACCAGACCTAGG + Intergenic
1164121712 19:22271699-22271721 ACAAAGGTCCAACCAGACCTAGG - Intergenic
1164130867 19:22360565-22360587 ACAAAGGTCCGACCAGACCTAGG - Intergenic
1164173405 19:22747179-22747201 ACAAAGGTCCAACCAGACCTAGG + Intergenic
1164217478 19:23162326-23162348 ACAAAATTCCGACCAGACCTAGG - Intergenic
1164323300 19:24169759-24169781 ACAAAGGTCTGACCAGACCTAGG - Intergenic
1164992560 19:32694981-32695003 CTGAAGGTCTGACCAGACATAGG - Intronic
1165532743 19:36417920-36417942 ACAAGGCTCAGACCCGACCTTGG - Intronic
1167607139 19:50487534-50487556 ACAAAGGTCTGTCCACTCCTGGG + Exonic
1167906736 19:52666784-52666806 GCAAAGGTCTGACCAGGCCTAGG + Intronic
1168198024 19:54790271-54790293 ACTAAGGTCTGACCACTCGTAGG - Intronic
924974278 2:158661-158683 ACAAAGATCCAACCAGACATAGG - Intergenic
926491602 2:13531834-13531856 TAAAAGGTCTTATCAGACCTAGG - Intergenic
926503195 2:13679810-13679832 ACAGAGGTCTGACCAGACCTAGG + Intergenic
926864228 2:17340949-17340971 ACAAAGGTCCCACCAGACCTAGG + Intergenic
927274951 2:21254772-21254794 ACACAGGCTTGACCTGACCTGGG + Intergenic
928347954 2:30518257-30518279 ACAAAGTTCTAACCAGACCTAGG + Intronic
928676889 2:33659302-33659324 ACAAAGGTCCGACCAGACCTAGG + Intergenic
931540801 2:63327068-63327090 ACAAAGTTCTGACCAAATCTGGG + Intronic
932917430 2:75873751-75873773 ACAAAGGTCCGACCAGAACTAGG + Intergenic
933175490 2:79168469-79168491 ACAAAGGTCCGACCAGACCGAGG - Intergenic
933342376 2:81039266-81039288 ACAAAGGTCTGACCACACCTAGG + Intergenic
934672165 2:96221340-96221362 ACAAAGGTCCGACCAGATCTAGG - Intergenic
934867587 2:97826958-97826980 ACAAAGGTCCGACCAGACCTAGG + Intronic
935048184 2:99500397-99500419 ACAAAGGTCCAACCAGACCTAGG + Intergenic
935247886 2:101235074-101235096 AAAAAGGTCCGACCAGATCTAGG + Intronic
935748602 2:106211074-106211096 ACAAAAGTCCGACCAGACCTAGG + Intergenic
936716588 2:115193883-115193905 ACAAAGGCCCGACCAGACCTAGG - Intronic
937057422 2:118951263-118951285 AGAAAGGTCCCACCAGACCTAGG - Intronic
937411518 2:121680962-121680984 ACAAAGGTCCGACCAGACCTAGG - Intergenic
938064098 2:128271832-128271854 ACAGTGGTCTGACCACACCGTGG + Intronic
938526947 2:132142992-132143014 ACAAAGGTCTGACCAGACTTAGG - Intergenic
938577115 2:132615154-132615176 CCCAAGCTCTGACTAGACCTTGG - Intronic
938805723 2:134805616-134805638 ACAAAGATCTGACCAGATCTAGG - Intergenic
939493834 2:142905468-142905490 ACAAAGGTCCTACCAGACCTAGG - Intronic
940352583 2:152705789-152705811 ACAAATGTCTGACCAGACCTAGG + Intronic
940684821 2:156834399-156834421 AAAAAGCTCTGATCAGAGCTAGG + Intergenic
941243748 2:163071741-163071763 ACAAAGATCCGACCAGATCTAGG + Intergenic
941537340 2:166740159-166740181 ACAAAGGTCCGACCAGACCTAGG - Intergenic
942830630 2:180234760-180234782 ACAAAGGTCCTACCAGACCTAGG + Intergenic
943102841 2:183508886-183508908 ACAAAGGTCCGACCAGATCTAGG - Intergenic
943134220 2:183891215-183891237 ACAAAGTTCCGACCAGATCTAGG + Intergenic
943597990 2:189879968-189879990 TCTATGGTCTGGCCAGACCTAGG + Intronic
943902238 2:193455217-193455239 ACAAAGGTCCGACCAGACCTAGG + Intergenic
944039500 2:195337864-195337886 ACAAAAGTCCGACCAGACCTAGG - Intergenic
945323633 2:208456677-208456699 ACAAAGGTCTGACTAGAAAGTGG - Intronic
945720114 2:213408601-213408623 ACAAAGGTCCGACCAGACCCAGG + Intronic
1168823962 20:796389-796411 ACAAAGGTTTGACCAGACCTGGG + Intergenic
1169811272 20:9611566-9611588 TCAAAGGGGTGACTAGACCTTGG - Intronic
1171270966 20:23816781-23816803 ACAAAGGTCCGACCAGATCTAGG + Intergenic
1171302203 20:24073215-24073237 CCAACGGTCTGAACAGATCTTGG - Intergenic
1172340887 20:34156541-34156563 ACAAAGGTCTGACCAGACCAAGG + Intergenic
1175513991 20:59557024-59557046 ACAAAGGTCTGACCAGACCTAGG - Intergenic
1176407532 21:6429567-6429589 ACAACGGACTGAGCAGACCAAGG - Intergenic
1176769578 21:13057009-13057031 ACAAAGGTCTGACCAGACCTAGG + Intergenic
1177263746 21:18758492-18758514 ACAAAGGTCCGACCAGACCTAGG - Intergenic
1177895988 21:26856560-26856582 ACAAAGGTCTGACCACACCTAGG + Intergenic
1178109539 21:29356582-29356604 ACAAAGGTCTGACCAGATCTAGG - Intronic
1179259359 21:39744583-39744605 ACAAAGGTCCGACCAGACCTAGG - Intergenic
1179683035 21:43037970-43037992 ACAATGGACTGAGCAGACCAAGG - Intergenic
1179795821 21:43782695-43782717 AGGAAGGACTGACAAGACCTGGG + Intergenic
1179820152 21:43932303-43932325 ACGGAGGTCTCACCAGAACTGGG - Intronic
1180434475 22:15287146-15287168 ACAAAGGTCTGACAAGACCTAGG + Intergenic
1180516679 22:16150953-16150975 ACAAAGGTCTGACCAGACCTAGG + Intergenic
1182311810 22:29414655-29414677 ACAAAGGTCTGACCAGACCTAGG - Intronic
1182651839 22:31858102-31858124 ACAAAGCTCAGGCCAGATCTTGG - Intronic
1182688457 22:32138649-32138671 ACAAAGATCCGACCAGACCTAGG + Intergenic
1184157612 22:42678648-42678670 GCAATGGCCTGACCTGACCTTGG - Intergenic
949574027 3:5321340-5321362 AGAAAGGTGGGCCCAGACCTAGG + Intergenic
949610165 3:5696100-5696122 ACAAAGGTCCGACCAGACCTAGG - Intergenic
949611362 3:5706985-5707007 ACAAAGGTCCAACCTGACCTAGG - Intergenic
950594770 3:13970025-13970047 ACAAAGGTCTGACCAGTCCTAGG - Intronic
951020972 3:17780518-17780540 ACAAAGGTCCGACCAGACCTAGG + Intronic
951200946 3:19874905-19874927 ACAAAGGTCCGACCAGACCTAGG - Intergenic
951239811 3:20274585-20274607 ACAAAGTTCAGACCAGATCTAGG + Intergenic
952545048 3:34409972-34409994 ACAAAGGTCTCACAATACCTGGG + Intergenic
952554838 3:34520259-34520281 ACAAAGGTTCCACCAGACCTAGG - Intergenic
952922455 3:38295160-38295182 ACAAAGATCTGACAAGACCTAGG - Intronic
952940482 3:38440534-38440556 ACAAAGATCTGAACAGACCTAGG - Intergenic
952983978 3:38761144-38761166 CCAAGGGTCCAACCAGACCTTGG + Intronic
953622477 3:44545026-44545048 ACAAAGTTCAGAGCAGACCTAGG - Intergenic
953725761 3:45396954-45396976 ACAAAGCTAGGACCAGAACTGGG + Intronic
954096683 3:48334168-48334190 GCAAAGGTCCAACCAGACCTAGG - Intergenic
954599266 3:51855096-51855118 ACAAAGGTCAGACCAGATCTAGG + Intergenic
956842610 3:73154549-73154571 ACAAAGGTCTGACCAGATCTAGG - Intergenic
958016495 3:87944534-87944556 ACAAAGGTCCGACCAGACCTAGG - Intergenic
958601568 3:96301549-96301571 ACAAAGGTCCAACCAGACCTAGG + Intergenic
958630039 3:96672574-96672596 ACAAAGCCCCAACCAGACCTAGG - Intergenic
959840427 3:110968618-110968640 ACAAAAGTCAGGCCAGATCTAGG - Intergenic
960063944 3:113350930-113350952 ACAGGGGTCTGACCAGACCTAGG + Intronic
960695776 3:120394977-120394999 TCAAAGGTTTTACCAGCCCTTGG - Exonic
960720520 3:120621055-120621077 ACAAAGGTCCGACAAGACCTAGG - Intergenic
962097222 3:132304558-132304580 ACAAAGGTCGGACCAGACCTAGG + Intergenic
962938538 3:140104383-140104405 ACAAATGTCAGAAAAGACCTAGG + Intronic
963604651 3:147404286-147404308 ACAAAAGGCTGACAGGACCTGGG - Intronic
963607907 3:147428013-147428035 AAAATGCTCTGACCAGCCCTGGG - Intronic
963697207 3:148576601-148576623 ACCAAGGTCCTACCAGATCTAGG + Intergenic
963915547 3:150856031-150856053 ACAAAGGTCTGACCAGACCTAGG + Intergenic
963991830 3:151665089-151665111 ACAAAGGTCCAACCAGACCAAGG - Intergenic
964933205 3:162050663-162050685 ACAAAGGTCCCATCAGACTTAGG - Intergenic
964953190 3:162323043-162323065 ACAAAAGTCCGACCAGACCTAGG + Intergenic
964972465 3:162578618-162578640 ACAAAGGTCTGACCAGATCTAGG + Intergenic
965054961 3:163699841-163699863 ACGAAGGTCCAAGCAGACCTAGG - Intergenic
965323048 3:167270914-167270936 CCAAAGGTCAGACCAGACCTAGG + Intronic
965409282 3:168309781-168309803 ACCAATGTCTGACCTGCCCTTGG + Intergenic
965825001 3:172721307-172721329 ACAAAGGTCTGAGCAGACCTAGG + Intergenic
967584134 3:191191626-191191648 ACAAAAGTCCAACCAGACATAGG + Intergenic
967623349 3:191660484-191660506 ACAAAGGTCCAACCAGAGCTAGG + Intergenic
968262091 3:197333643-197333665 TCAAAGCTCTGACCTGACCAGGG + Intergenic
968391345 4:195425-195447 ACAAAGGTCCGACCAGACTAAGG - Intergenic
969311642 4:6356405-6356427 AGAAGGGTCAGACCAGGCCTGGG + Intronic
970092834 4:12429373-12429395 ACAAAGGTCCAGCCAGACCTAGG - Intergenic
971389345 4:26171650-26171672 ACAAAGGACTGTCCACTCCTGGG + Intronic
971578917 4:28308856-28308878 ACAAAAGTCCGACCAGACCTAGG + Intergenic
971669874 4:29542921-29542943 ACAAAGTTGTGGCCAAACCTGGG - Intergenic
972651311 4:41020308-41020330 ACAAAGGTCCAACTAGATCTAGG + Intronic
972784810 4:42316537-42316559 ACAAAGGTCTGATCAGATCTAGG + Intergenic
974520233 4:62973326-62973348 ACAAAGGTCCGACCAGACCTAGG + Intergenic
974747971 4:66101337-66101359 ACAAAGTTTAGACCAGAACTAGG + Intergenic
975205506 4:71640187-71640209 ACAAAGGTCTGACCAGACCTAGG + Intergenic
975314083 4:72932041-72932063 ACAAAGGTCGGACCAGACCTAGG - Intergenic
976189596 4:82475684-82475706 ACAAAGGTCCAACCAGACCTAGG + Intergenic
977043720 4:92044237-92044259 ACAAAGTTCCGACCAGACCTAGG - Intergenic
977618181 4:99107978-99108000 ACGAAGGTCCCACCAGACCTAGG - Intergenic
977640643 4:99354718-99354740 ACAAAGTTCCTACCAGATCTAGG + Intergenic
977834477 4:101632500-101632522 ACAAAGGTCTGATCAGATCTAGG - Intronic
977972225 4:103225608-103225630 ACAAAGGTCTGACCAGACCTAGG + Intergenic
978310951 4:107384439-107384461 ACAAAAGTTTGACCAGAATTAGG + Intergenic
978314005 4:107415850-107415872 ACAAAGGTCTGACCAGACCTAGG + Intergenic
978909294 4:114046311-114046333 ACAAAGGTCCGACCAGACCTAGG + Intergenic
980438969 4:132816665-132816687 ACAAAGGTCTGACCAGACCTAGG - Intergenic
980444068 4:132884261-132884283 ACAAAGGTCTGACCAGACCTAGG + Intergenic
981602270 4:146503562-146503584 ACAAAGGACAGAGAAGACCTGGG - Intronic
983708241 4:170684747-170684769 ACAAAGGTCTGACCAGACCTAGG + Intergenic
984508055 4:180644450-180644472 ACAAAGTTCTCATCAAACCTGGG - Intergenic
985230260 4:187808372-187808394 ACAAAGGTGTGACCATCCCATGG - Intergenic
986933626 5:12856282-12856304 ACAAAGGTCCGACCAGCTCTAGG + Intergenic
987931041 5:24399522-24399544 ACAAAGGTCCAACCAGATCTAGG + Intergenic
988358233 5:30203512-30203534 ACAAAGGTCCGACCAGACCTAGG + Intergenic
988457260 5:31397285-31397307 ACAAAGGTCCGACCAGACCTAGG - Intergenic
988740252 5:34062703-34062725 AAAAAGATCTGACCTGATCTGGG - Intronic
989096194 5:37783912-37783934 ACAAAGGTCTGATCAGACCTAGG - Intergenic
989098807 5:37805964-37805986 AGTAAGGTTTGACCAGACCACGG - Intergenic
989964158 5:50449485-50449507 ACAAAGGTCCGACCAGACCTAGG - Intergenic
990117057 5:52402301-52402323 ACAATGGTCCAACCAGACCTAGG + Intergenic
990178109 5:53129712-53129734 ACAGAGCTGGGACCAGACCTGGG - Intergenic
990367543 5:55086256-55086278 ACAAAGGTCCGACCAGATCTAGG - Intergenic
990419371 5:55616444-55616466 ACAAAGGTCCGACCAGACTTAGG + Intergenic
990892089 5:60660825-60660847 ACAAAGGTCCAACCAGACCTAGG + Intronic
991305919 5:65175797-65175819 ACAAAGGTCTGACCAGACCTAGG + Intronic
992024906 5:72660399-72660421 ACAAAGGTCTTCCTAGACATTGG + Intergenic
992293747 5:75306337-75306359 ACAAAGATCCAACCAGACCTAGG + Intergenic
992455653 5:76913264-76913286 ACAAAGGTCCGATCAGACCAAGG + Intronic
993045744 5:82864395-82864417 ACAGAGTTCTCACAAGACCTGGG + Intergenic
993055353 5:82974150-82974172 ACAAAGGTCCAACCAGACCTAGG - Intergenic
993307838 5:86292678-86292700 ACAGAGGTGAGACCAGACATAGG - Intergenic
995465421 5:112445744-112445766 ACAAAGGTCCAACCAGACCTAGG + Intergenic
996098901 5:119427896-119427918 ACAAAGGTCCGACCAGATCTAGG - Intergenic
998552714 5:143092987-143093009 ACAAAGGTCCGAGCAGACCTAGG - Intronic
998915397 5:147006082-147006104 ACAAAGGTCTGACCACATCTAGG + Intronic
1000236684 5:159368045-159368067 ACAAAGGTCCAACCAGACCTAGG + Intergenic
1001558605 5:172654425-172654447 GCAAAGGTCTCACCAGACCTAGG - Intronic
1002999270 6:2316206-2316228 ACAAAGGACCAACCAGACCTAGG - Intergenic
1003423127 6:5975779-5975801 CCAAAGGTCTGACGATAACTGGG - Intergenic
1003805997 6:9726446-9726468 ACAAAGGTCTGACAAGATCTAGG + Intronic
1005323893 6:24681023-24681045 ACAAAGGTCCGACCAGACCTAGG - Intronic
1005461783 6:26075911-26075933 ACAAAGCTCTGACCAGACCTAGG + Intergenic
1006222044 6:32499440-32499462 ACAAAGGTCCAACCAGATCTAGG + Intergenic
1007953271 6:45892356-45892378 AGAAAGGAGTGACCACACCTTGG + Intergenic
1008001053 6:46360208-46360230 ACCAAGGTCTTAAGAGACCTGGG + Intronic
1008123326 6:47642358-47642380 GCAAAGGTCAGACCAGACCTAGG + Intergenic
1008582528 6:52919853-52919875 ACAAAGGTCCAACCAGACCTAGG - Intergenic
1009544553 6:65006662-65006684 ACAAAGGTCCGACCAGAGCTAGG + Intronic
1009635614 6:66260745-66260767 ACAAAGGTCCGACCAGACCTAGG + Intergenic
1010075278 6:71790650-71790672 ACAAAGGTCCGACCAGATCTAGG + Intergenic
1010893270 6:81339055-81339077 ACAAAGGTCTGACCAGACCTAGG + Intergenic
1011076622 6:83445524-83445546 ACAAAAGTACGACCAGACCTAGG + Intergenic
1011190032 6:84718789-84718811 ACAAAGGTCCAAACAAACCTAGG - Intronic
1011540131 6:88419669-88419691 ACAAAGGTCCGACCAGACCTAGG - Intergenic
1011570201 6:88726546-88726568 ACAAAGGTCCGACCAAACCTAGG + Intronic
1012441082 6:99262981-99263003 ACAAAGGTCCAACCAGATCTAGG - Intergenic
1013022015 6:106230031-106230053 ACAAAGGTCCGACCAGACCTAGG + Intronic
1013977623 6:116095156-116095178 CCAAAGGTCCAACCAGACCTAGG + Intergenic
1015342553 6:132118356-132118378 ACAAATGTGTGTCCAAACCTAGG - Intergenic
1016343413 6:143085852-143085874 ACAAAGGTCCGACCAGACCTAGG - Intronic
1018191550 6:161313754-161313776 ACAAAGGTCCAACCAGACCTAGG - Intergenic
1018269756 6:162064520-162064542 ACAAAAGACTAACCAGTCCTAGG + Intronic
1018687359 6:166314229-166314251 ACAAAGGTCTAACCAGACCCAGG + Intergenic
1018760810 6:166892953-166892975 ACAAAGGTCCGACCAGATCTAGG + Intronic
1020044032 7:5026996-5027018 ACAAAGGTCTGACCAGACCTAGG - Intronic
1020507946 7:9017791-9017813 ACAAAAGTCCGACCAGACCTAGG + Intergenic
1021356141 7:19655163-19655185 ACAAAGGTCCAACTAGACCTAGG - Intergenic
1021756275 7:23856160-23856182 ACAAAGGTCCAACCAGACCTAGG - Intergenic
1022489995 7:30809476-30809498 ACAAAGGCCCGACCAGACCTAGG + Intronic
1023077756 7:36500664-36500686 ACAAAGGTCTGACCAGACCTAGG - Intergenic
1023436512 7:40145941-40145963 ACAAAGGTCTGACCAGACCTTGG - Intronic
1023439506 7:40171451-40171473 ACAAAGGTCCAACCAGACCTAGG - Intronic
1023798473 7:43813154-43813176 AAAAAGGTCTGACCAGACCTAGG + Intergenic
1023798929 7:43816191-43816213 ACAAAGCCTTGACCAGACCTAGG + Intergenic
1025256705 7:57388755-57388777 AGAAAGCCCTGACCTGACCTCGG - Intergenic
1025798257 7:64759878-64759900 ACAAAGGTCCTACCAGATATAGG - Intergenic
1027152393 7:75741790-75741812 ACAAAGGTGTGACCTGAGTTAGG - Intergenic
1028018276 7:85741661-85741683 ACAAAGGTCAGGACAGATCTAGG - Intergenic
1028333814 7:89626899-89626921 ACAAAGTTCCGACCAGACCTAGG + Intergenic
1028588838 7:92476089-92476111 ACAAAGGTCCGACCAGACCTAGG - Intronic
1028793588 7:94879721-94879743 ACAAAGGTCCGACCCGACCTTGG + Intergenic
1030337070 7:108339177-108339199 ACAAAGGTCTGACCAGACCTAGG + Intronic
1030843750 7:114384581-114384603 ACAAAGGTCCGACCAGACCTAGG - Intronic
1031471260 7:122172066-122172088 GCAAAGGTCCGACCAGACCTAGG + Intergenic
1031732239 7:125313837-125313859 ACAAAGGTCAAACCAGATCTAGG + Intergenic
1032725600 7:134587681-134587703 ACAAAGGTCCAATGAGACCTAGG + Intergenic
1033097759 7:138445750-138445772 ACAAAGGTTCGACCAGACCTAGG - Intergenic
1034191238 7:149214964-149214986 CCAAATGTCTCACCAGACTTGGG + Intronic
1034249032 7:149673552-149673574 ACAAAGGTCCAACCGGAACTAGG + Intergenic
1034579440 7:152029805-152029827 ACAAAGGTCCGACCAGATCTAGG - Intronic
1036420858 8:8594200-8594222 ACACAGGTCTGCTCTGACCTGGG - Intergenic
1037151993 8:15648371-15648393 ACAAAGGCCTGACTAGACGCGGG + Intronic
1037570827 8:20156410-20156432 ACGAAGGTCTGACCAGACTCAGG + Intronic
1038089513 8:24237476-24237498 ACATAGGTCCAATCAGACCTAGG + Intergenic
1039276409 8:35937736-35937758 ACAAAGGTCCGACCAGACCTAGG + Intergenic
1039689434 8:39848371-39848393 CCAAAGGTCAGACCAGACCTAGG - Intergenic
1039876972 8:41595224-41595246 ACAAAGGTCCAACCAGACCTAGG - Intronic
1041011456 8:53547705-53547727 AAAAAGCTGTGACCAGCCCTGGG - Intergenic
1041226950 8:55709886-55709908 ACAAAGGTCTGACCAGACCTAGG + Intronic
1041800250 8:61790343-61790365 ACAAAGGACTGAGCAGACCCGGG - Intergenic
1042088088 8:65130644-65130666 ACAGAGGTCCGACCAGACCTAGG - Intergenic
1047444117 8:124904468-124904490 ACAAAGGTCCAACCAAACCTAGG - Intergenic
1050480618 9:6083702-6083724 ACAAAAGTTCGACCAGACTTAGG + Intergenic
1052289961 9:26829280-26829302 ACAAAGGTCCAACCAGATCTAGG + Intergenic
1052507932 9:29379073-29379095 ACAAAGGTCCTACCAGACCTAGG + Intergenic
1052529150 9:29658456-29658478 ACAAAGGTCCTACCAGACCTAGG - Intergenic
1052538671 9:29778885-29778907 ACAAAGGTCTGACCAGACCTAGG - Intergenic
1053110960 9:35459807-35459829 ACAAAGGTCCGACCAGACCTAGG - Intergenic
1053705643 9:40750347-40750369 ACAAAAGTCTGACCAGACCTAGG - Intergenic
1054415720 9:64873954-64873976 ACAAAAGTCTGACCAGACCTAGG - Intergenic
1056414617 9:86364461-86364483 ACAAAGGTTCGACCAGACCCAGG - Intergenic
1056704779 9:88942675-88942697 ACAAAGGTCTGACCAGACCTAGG - Intergenic
1059540714 9:115127699-115127721 ACAAATTCCAGACCAGACCTTGG + Intergenic
1060694124 9:125691513-125691535 AGAAAGGTCTGAGCAAACTTGGG + Intronic
1062592893 9:137281914-137281936 ACGAAGGCCAGACCAGAGCTGGG - Exonic
1186254271 X:7702078-7702100 ATAAAGGTCTGACCAGACCTAGG - Intergenic
1186912373 X:14182331-14182353 CCACAGTTCTGACAAGACCTTGG + Intergenic
1188097985 X:26046081-26046103 ACAAAGGTCCAACCAGACCTAGG + Intergenic
1188136962 X:26503320-26503342 ACAAAGGTCCAACCAGACCTAGG + Intergenic
1189245936 X:39563673-39563695 CCAAAGGTGTGACTAGGCCTAGG + Intergenic
1189399449 X:40652956-40652978 CCAAAGGTCTGCCCAGTCCAAGG + Intronic
1189551523 X:42098696-42098718 ACACAGGGCTGACCACACGTGGG + Intergenic
1189834056 X:45003292-45003314 ACAAAGGTCCGACCAGACCTAGG - Intronic
1190270068 X:48855656-48855678 ACAAAGGTCTGATCAGACCTAGG + Intergenic
1190292088 X:48999897-48999919 CCATATTTCTGACCAGACCTGGG + Intronic
1190771072 X:53514620-53514642 ACAAAGGTCCGACCAGACCTAGG + Intergenic
1191167245 X:57403798-57403820 ACAAATGTCTGAACAGACCTAGG - Intronic
1191890077 X:65930928-65930950 CCAAAGGTTCGACCAGACCTAGG - Intergenic
1191918123 X:66224388-66224410 ACAAAGTTCCAACCAGACCTAGG - Intronic
1192482315 X:71496211-71496233 ACAAAGGTCCGACCAGATCTAGG - Intronic
1192915621 X:75648450-75648472 ACAAAGGTCCAACCAGACCTAGG - Intergenic
1192940127 X:75903150-75903172 ACAAAGGTCTGACCAGACCTAGG - Intergenic
1193172124 X:78348610-78348632 ACAAAGGTCCGAGCAGACCTAGG - Intergenic
1193306486 X:79957801-79957823 ACAAAGGTCCGACCAGACCTAGG + Intergenic
1193717187 X:84946639-84946661 ACAAAGGTCCGACCAGACCTAGG + Intergenic
1195847074 X:109240327-109240349 ACAAAGGTCCATCCAGACCTAGG - Intergenic
1195850720 X:109279126-109279148 ACAAAGGTCTGATGAGACCTAGG - Intergenic
1196126922 X:112110876-112110898 ACAAAGGTACAACCAGATCTAGG - Intergenic
1198742304 X:139853996-139854018 ACAAAGGTCTGACCAGACCTAGG + Intronic
1199637607 X:149828184-149828206 ACAAAGGTCTGACCATACCTAGG + Intergenic
1200694681 Y:6348468-6348490 ACAAAGGTCCAACAAGACCTAGG - Intergenic
1200763441 Y:7060927-7060949 AGAAAGGTCCAACCAGACCTAGG - Intronic
1200851753 Y:7890519-7890541 ACAAAGATCCGACCACATCTAGG - Intergenic
1200945510 Y:8831449-8831471 ACAAAGGTCTGAGCAGACCTGGG + Intergenic
1201040596 Y:9826242-9826264 ACAAAGGTCCAACAAGACCTAGG + Intergenic
1201271763 Y:12262598-12262620 ACAAAGGTCCGACCAGACCTAGG - Intergenic
1201297320 Y:12475004-12475026 ATAAAGGTCTGACCAGACCTAGG - Intergenic
1201648574 Y:16261958-16261980 ACAAAGGTCTGACCAGGCCTAGG - Intergenic
1201654236 Y:16323343-16323365 ACAAAGGTCTGACCAGGCCTAGG + Intergenic
1201900064 Y:19039990-19040012 ACAAAGGTCGGACCATACCTAGG - Intergenic
1201919699 Y:19221109-19221131 ACAAAGGTCTGACCAGACCTAGG + Intergenic
1202089690 Y:21176906-21176928 ACAAAGGTCTGACTAGACCTAGG - Intergenic
1202192209 Y:22257154-22257176 ACAAAGGTCTGATCAGACCTAGG - Intergenic