ID: 1071283289

View in Genome Browser
Species Human (GRCh38)
Location 10:84122653-84122675
Sequence CTTAATTAATTACCATACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 453
Summary {0: 42, 1: 46, 2: 27, 3: 41, 4: 297}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071283289_1071283292 -2 Left 1071283289 10:84122653-84122675 CCTTTGTATGGTAATTAATTAAG 0: 42
1: 46
2: 27
3: 41
4: 297
Right 1071283292 10:84122674-84122696 AGATTTAGATCCCCTGGGCCTGG No data
1071283289_1071283290 -8 Left 1071283289 10:84122653-84122675 CCTTTGTATGGTAATTAATTAAG 0: 42
1: 46
2: 27
3: 41
4: 297
Right 1071283290 10:84122668-84122690 TAATTAAGATTTAGATCCCCTGG No data
1071283289_1071283291 -7 Left 1071283289 10:84122653-84122675 CCTTTGTATGGTAATTAATTAAG 0: 42
1: 46
2: 27
3: 41
4: 297
Right 1071283291 10:84122669-84122691 AATTAAGATTTAGATCCCCTGGG No data
1071283289_1071283293 6 Left 1071283289 10:84122653-84122675 CCTTTGTATGGTAATTAATTAAG 0: 42
1: 46
2: 27
3: 41
4: 297
Right 1071283293 10:84122682-84122704 ATCCCCTGGGCCTGGTGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071283289 Original CRISPR CTTAATTAATTACCATACAA AGG (reversed) Intergenic
901584772 1:10280134-10280156 CTTGATGAATTACCTTAAAAGGG - Intronic
901946614 1:12709305-12709327 TTTAATTGATTACCACACAAAGG - Intergenic
902031928 1:13429233-13429255 CTTAATTAATTACCATACAAAGG + Intergenic
904571294 1:31467774-31467796 CTTAATTAATTACCATACAAAGG - Intergenic
904580879 1:31543442-31543464 GTCAATTAATAACCCTACAATGG - Intergenic
904665395 1:32116823-32116845 GCTAATTAATAACCCTACAATGG - Intronic
904713128 1:32446671-32446693 CTTAATTAATTACCATACAAAGG - Intergenic
904761281 1:32806021-32806043 GCTAATTAATAACCCTACAATGG - Intronic
905415521 1:37801246-37801268 CTTAAGAAATTACTAAACAATGG + Intergenic
906507579 1:46391659-46391681 CTTAATTAATTACCATACAAAGG - Intergenic
907085011 1:51663736-51663758 CTTAATTTATAACCATTGAAGGG + Intronic
908091657 1:60692197-60692219 GTCAATTAATAACCACACAATGG + Intergenic
908300887 1:62760140-62760162 CTTAACTAATTACCATACAAAGG + Intergenic
908973968 1:69874510-69874532 CTTGATTAAATACAATTCAAAGG + Intronic
909280714 1:73748770-73748792 ATTATTTAATTACCATAAATTGG + Intergenic
909322082 1:74302345-74302367 GTTAATTAATAACTCTACAATGG + Intronic
909916098 1:81321505-81321527 GCCAATTAATAACCATACAATGG - Intronic
910592194 1:88937960-88937982 ATTAATTAATTATTATAAAAAGG + Intronic
910808250 1:91210279-91210301 CTTAATTAATGACTATACAAAGG - Intergenic
911187090 1:94915134-94915156 CCTTATGAAATACCATACAAAGG + Intronic
911299189 1:96152008-96152030 CTTAATTAATTACCATGCAAAGG + Intergenic
911706278 1:101016832-101016854 GTCAATTAATAACCCTACAATGG - Intronic
912339435 1:108897076-108897098 TTAAATTAATTACCTTGCAAGGG - Exonic
914437458 1:147672311-147672333 CTTAATTATATGCCAAACAAGGG - Intergenic
916084136 1:161256219-161256241 CTTAATTAATTACCATACAAAGG + Intergenic
916669334 1:166999089-166999111 GTCAATTAATAACCCTACAATGG + Intronic
917227795 1:172802495-172802517 CTTAATTAATTACCATACAAAGG + Intergenic
917676586 1:177324422-177324444 CTTAATTAGTTACCATACGAAGG + Intergenic
919257253 1:195140558-195140580 CTTAATTAATTACCATACAAGGG + Intergenic
919559171 1:199096327-199096349 TTTAATTAATTACCATACAAAGG + Intergenic
922032469 1:221814906-221814928 GGTAATTAATAACCCTACAATGG + Intergenic
922065589 1:222136392-222136414 GTCAATTAATAACCCTACAATGG - Intergenic
922143962 1:222919159-222919181 CTTAATTAATTAAAAAACAAAGG + Intronic
924241173 1:242042197-242042219 CTTAATTAACTAGAATAAAAAGG + Intergenic
1063415165 10:5867240-5867262 CTTAACTAATTACCATACAAAGG + Intronic
1064210498 10:13357133-13357155 CTTAGTTTTTTACCATACTAAGG - Intergenic
1064756297 10:18574453-18574475 TTTAATTTATTATCATACAAAGG + Intronic
1064763549 10:18647039-18647061 CTTATTTAATTATTATACTAAGG + Intronic
1065082893 10:22144743-22144765 CTTAATTAATTACCATACAAAGG + Intergenic
1065410884 10:25426503-25426525 GTCAATTAATAACCATACAATGG - Intronic
1066590771 10:36991919-36991941 CTGTTTTAATTTCCATACAAAGG - Intergenic
1066976781 10:42376543-42376565 ATTAATAAATTATCATAAAATGG - Intergenic
1067146387 10:43697152-43697174 CATAACAAATTACCACACAACGG + Intergenic
1068115082 10:52728597-52728619 CTTAATAAATTACTAGGCAAAGG + Intergenic
1068240882 10:54299613-54299635 CTTAATGAATTACCATACAAAGG + Intronic
1068532149 10:58201621-58201643 ATTAATTAATAACCCTCCAATGG + Intronic
1068870123 10:61934528-61934550 GCTAATTAATAACCCTACAATGG - Intronic
1069126564 10:64642478-64642500 GTGAATTAATAACCCTACAATGG + Intergenic
1069364748 10:67685505-67685527 CATAATTAATTACCATACAAAGG - Intronic
1070268397 10:74927245-74927267 CCTAATTCATTACTATACTATGG - Intronic
1071283289 10:84122653-84122675 CTTAATTAATTACCATACAAAGG - Intergenic
1071835205 10:89411198-89411220 CTTAATTAATTCCCATACAAAGG + Intronic
1072391949 10:94996435-94996457 CTTAATTAATTACCATACAAAGG - Intergenic
1073501505 10:103942275-103942297 CATAAATGATTACAATACAATGG - Intergenic
1074725593 10:116305378-116305400 GCCAATTAATAACCATACAATGG - Intergenic
1074742430 10:116498250-116498272 CTTAATTAATTACCATACAAAGG - Intergenic
1075436154 10:122444004-122444026 CTTAATAATTTACCACACAAAGG + Intergenic
1077398328 11:2338292-2338314 CTTAATGAATTACCATACAAAGG + Intergenic
1079255036 11:18820418-18820440 AAAACTTAATTACCATACAAAGG - Intergenic
1079811189 11:25001435-25001457 CTTAATTAATTACCATACAAAGG - Intronic
1080118851 11:28651562-28651584 CTTAATTAATGAGGAAACAATGG - Intergenic
1080240263 11:30119503-30119525 GTTAAATAGATACCATACAATGG + Intergenic
1083135205 11:60667288-60667310 GCCAATTAATAACCATACAATGG + Intergenic
1083303182 11:61749394-61749416 CTTAATTGATTATAATGCAATGG + Intergenic
1083375776 11:62219429-62219451 TTTAATTGACTACCAAACAAAGG + Intergenic
1083976058 11:66121367-66121389 GTCAATTAATAACCCTACAATGG + Intronic
1085077643 11:73605931-73605953 CTTAACAAATTACCATAAACTGG - Intergenic
1085835057 11:79946387-79946409 CAAAATTAATTACCTTATAAAGG - Intergenic
1085873608 11:80380231-80380253 TATAATTAATTACAATGCAATGG - Intergenic
1086317882 11:85612301-85612323 CTTAACTAATTATCATACGAAGG + Intronic
1086649725 11:89273282-89273304 GTCAATTAATAACCCTACAATGG - Intronic
1086987284 11:93264051-93264073 TTTAACTGATTATCATACAATGG + Intergenic
1087126484 11:94631838-94631860 TTTCAGTAATTACCATACTATGG + Intergenic
1087458780 11:98420979-98421001 CTTAGTTGATTACCATGCAAAGG - Intergenic
1088724555 11:112622620-112622642 CTTAATGAATTACCACAAACTGG - Intergenic
1089206238 11:116765662-116765684 ATTAATCAATTACCCTGCAAAGG + Intronic
1090983311 11:131743288-131743310 CTTAAATAACTACCAGACACTGG - Intronic
1091514992 12:1170312-1170334 TTTAAATTATTACAATACAATGG + Intronic
1093356570 12:18174457-18174479 CTTAATTAACTACTATACAAAGG + Intronic
1094234356 12:28146554-28146576 ATTAAGTAATTGCCATATAAAGG + Intronic
1094815833 12:34182816-34182838 CTTAATTAACTAGAATAAAAAGG - Intergenic
1095101316 12:38187669-38187691 CTTAATTAAATAGAATAAAAAGG + Intergenic
1095284748 12:40395634-40395656 GCTAATTAATAACCCTACAATGG - Intronic
1097518179 12:60633761-60633783 GTCAATTAATAACCCTACAATGG + Intergenic
1098921770 12:76309116-76309138 GTCAATTAATGACCCTACAAAGG - Intergenic
1099343208 12:81465202-81465224 CTTAATTAATGAACTGACAATGG + Intronic
1100050659 12:90445079-90445101 CTTAATTAATTACCATACAAAGG - Intergenic
1100719299 12:97340593-97340615 CTTAATTCATTGTCATAAAATGG + Intergenic
1102606151 12:114068960-114068982 TTTAATTGATTACCAAACAAAGG + Intergenic
1103211603 12:119171077-119171099 CTTAATTATATGCCAAACAAGGG + Intergenic
1105225524 13:18427970-18427992 TTTAACTGATTACCATACAAAGG + Intergenic
1105450860 13:20498619-20498641 ATTAATAATATACCATACAAAGG + Intronic
1105589649 13:21779527-21779549 GCCAATTAATTACCCTACAATGG + Intergenic
1107723970 13:43278923-43278945 TTTCATTAATTATCATAAAATGG - Intronic
1108515838 13:51201714-51201736 CTTAATTAATTACCATACGAAGG - Intergenic
1108849078 13:54706007-54706029 CTTAATTAGTTACCATACAAAGG + Intergenic
1109108477 13:58285876-58285898 CTTAATTTATCACAATAAAATGG + Intergenic
1109330954 13:60929247-60929269 CTGAATTAATTAGCCTAAAATGG - Intergenic
1110850214 13:80237005-80237027 GCTAATTAATTACCTTTCAAAGG + Intergenic
1111248177 13:85569285-85569307 CATAACTAATGACCATAAAATGG - Intergenic
1113137548 13:107110118-107110140 TCTAATTAATAACCTTACAATGG - Intergenic
1114009975 14:18356321-18356343 TTTAACTGATTACCATACAAAGG + Intergenic
1114474478 14:22984071-22984093 CCTAATTAAATACCAGCCAACGG + Intergenic
1115873728 14:37837001-37837023 TTTAATTAATTACAACATAAGGG + Intronic
1116725699 14:48559147-48559169 TTTAATTAATTACCACACAAAGG + Intergenic
1117238753 14:53806414-53806436 CTTAATGAATCTCCATCCAATGG - Intergenic
1119110332 14:71967226-71967248 CTATATTAATTACCATAAAAGGG + Intronic
1120471866 14:84935757-84935779 CTTGGTTAATCAGCATACAAGGG - Intergenic
1120544134 14:85789405-85789427 GCTAATTAATAACCCTACAATGG + Intergenic
1120993772 14:90399474-90399496 CTTAATTATTTCTCATAAAATGG + Intronic
1121142115 14:91552374-91552396 CATAACTAAATACCATACACTGG - Intergenic
1121277882 14:92680007-92680029 CTTAATAAAATACCATAAACTGG + Intronic
1121376901 14:93419716-93419738 CTTAAATAAAAAACATACAAAGG + Intronic
1121461473 14:94081889-94081911 GTCAATTAATAACCCTACAATGG + Intronic
1122382518 14:101318905-101318927 TTTAACTGATTACCATACAAAGG + Intergenic
1122431790 14:101655071-101655093 GTCAATTAATAACCCTACAATGG + Intergenic
1125099575 15:35895616-35895638 GCCAATTAATTACCCTACAATGG - Intergenic
1125690095 15:41589055-41589077 TTTAATTGATTACCATACAAAGG + Intergenic
1126451999 15:48818506-48818528 CTAATTTAATTACTTTACAAAGG + Intergenic
1127028734 15:54837040-54837062 CTTTATTGACTACTATACAAAGG + Intergenic
1128690153 15:69718316-69718338 CCCAATTAATAACCATAAAATGG - Intergenic
1130301759 15:82684986-82685008 ATCAATTAATAACCCTACAATGG - Intronic
1134670138 16:16048549-16048571 AGTAATTAACTACCCTACAATGG + Intronic
1135506646 16:23043329-23043351 GTCAGTTAATAACCATACAATGG - Intergenic
1137461645 16:48669816-48669838 CTTATGTAATTAACACACAAAGG - Intergenic
1138202860 16:55102905-55102927 CTCAATTAATTAACAAAAAATGG + Intergenic
1138975578 16:62203174-62203196 TTTAATTAATGTCCATAGAAGGG - Intergenic
1140615309 16:76655948-76655970 CTTACTTAATTTACATAAAAAGG + Intergenic
1140650557 16:77083523-77083545 CTTAACCAATTACCATAGATTGG - Intergenic
1141940148 16:87270481-87270503 CTTGATTGATAACAATACAAAGG - Intronic
1144169597 17:12647243-12647265 CTTAATTTATTACCATGCAGGGG - Intergenic
1149019527 17:51947109-51947131 CTTAAATAATTACATTATAAAGG - Intronic
1149518448 17:57299464-57299486 CCCAATTAATAACCCTACAATGG - Intronic
1153438279 18:5089469-5089491 CTTAATTAATTACCATACAAAGG + Intergenic
1153826566 18:8880706-8880728 CTTAATTAATTACCATACAAAGG - Intergenic
1154527851 18:15311552-15311574 TTTAACTGATTACCATACAAAGG - Intergenic
1154953202 18:21229926-21229948 GTCAATTAATAACCCTACAATGG - Intergenic
1155266151 18:24095884-24095906 GTTGATTAATAACCCTACAATGG - Intronic
1156395465 18:36695588-36695610 CCTGATTACTTAACATACAATGG - Intronic
1156972554 18:43173595-43173617 ATTAATTAATCAACATACAAGGG + Intergenic
1157349684 18:46873344-46873366 TTTAATTGATTATCACACAAAGG + Intronic
1162108377 19:8385242-8385264 CTTAATTAATTACCATACAAAGG + Intronic
1162268037 19:9592147-9592169 TTTAATTGATTACCATAGAAAGG - Intergenic
1162319583 19:9963206-9963228 ATTAATTAATTAAAATAAAATGG - Intronic
1164901191 19:31925933-31925955 GACAATTAATTACCCTACAATGG - Intergenic
1167906733 19:52666768-52666790 CTTAATTATTTACCATGCAAAGG + Intronic
926503193 2:13679794-13679816 CTTAATTAATGACCATACAGAGG + Intergenic
926864226 2:17340933-17340955 AAAACTTAATTACCATACAAAGG + Intergenic
927104126 2:19809586-19809608 CTTTATTAATCACCATCCCATGG - Intergenic
927618078 2:24620876-24620898 CTTACTTAAGTAGCATAGAAAGG - Intronic
928607547 2:32957389-32957411 GCTAATTAATAACCCTACAATGG - Intronic
928787134 2:34902219-34902241 CTTAAGTAATTGCCATCAAAAGG + Intergenic
930337479 2:50068203-50068225 CTTAAATTATTTGCATACAATGG - Intronic
931060200 2:58520110-58520132 ATTATTTAAATACCAAACAAAGG + Intergenic
931580948 2:63773531-63773553 CTTAATAAATTTTTATACAATGG - Intronic
932857382 2:75250552-75250574 GCCAATTAATTACCCTACAATGG - Intergenic
933342375 2:81039250-81039272 CTTAATTAATTACGATACAAAGG + Intergenic
933389691 2:81654050-81654072 TTTAATTGATTACCATACGAAGG - Intergenic
933465005 2:82640964-82640986 CTCAATTAATAACCAAAAAAAGG + Intergenic
933528406 2:83473602-83473624 ATTAATAAATTAACATAAAATGG + Intergenic
934767706 2:96889228-96889250 CTTAGTTTCTTTCCATACAATGG + Intronic
934867586 2:97826942-97826964 CTTAACTAATTACTATACAAAGG + Intronic
935247884 2:101235058-101235080 CTTAATTAATTACCATAAAAAGG + Intronic
935724726 2:106013544-106013566 CTTGATTACATACCAAACAAGGG - Intergenic
935796909 2:106651359-106651381 ATCAATTAATAACCCTACAATGG - Intergenic
935948754 2:108309959-108309981 CTGAATTAATTTCCATACAAAGG - Intergenic
935962376 2:108438902-108438924 GTTAATTATATACCATACAAGGG - Intergenic
936409566 2:112244902-112244924 ACTAATTAATAACCCTACAATGG + Intronic
936668871 2:114632346-114632368 CTTAATAAATTACAATACTATGG + Intronic
936716590 2:115193899-115193921 TTTAATTAATTACCATACAAAGG - Intronic
937411520 2:121680978-121681000 CTTAATTAACTACCATACAAAGG - Intergenic
937621633 2:123994733-123994755 ACCAATTAATTACCCTACAATGG + Intergenic
938217972 2:129537645-129537667 CTTCATTCATGTCCATACAAAGG - Intergenic
938372159 2:130776972-130776994 CTTTATTTATTACAAAACAAAGG + Intergenic
938526949 2:132143008-132143030 TTTAACTGATTACCATACAAAGG - Intergenic
938904125 2:135822884-135822906 CTGGATTAGTTACCATACAGTGG + Intronic
939194620 2:138956574-138956596 CTTAACAAATTACCATAAACCGG + Intergenic
939319543 2:140599930-140599952 GTTAATCTATTAACATACAATGG + Intronic
939668428 2:144979292-144979314 TTGAATTAATGACCAAACAAAGG - Intergenic
941179532 2:162241612-162241634 TTTAATGAATTAACATTCAAAGG + Intronic
941386207 2:164855653-164855675 CCAAATTAATAACCCTACAATGG - Intergenic
943102843 2:183508902-183508924 CTTAATTAATTACCATACAAAGG - Intergenic
943545295 2:189269162-189269184 ATTAATTTTTTTCCATACAAGGG - Intergenic
943630789 2:190249639-190249661 CTTAGAAAATTACCATACAGAGG - Exonic
943797433 2:192014161-192014183 GGTATTTAATTACCAAACAATGG + Intronic
943902237 2:193455201-193455223 CTTAATTAATTACGATACAAAGG + Intergenic
943930265 2:193842346-193842368 ATTAATTAATTACAATGTAAAGG - Intergenic
943935461 2:193909711-193909733 GTCAATTAATAACCCTACAATGG + Intergenic
943952498 2:194148241-194148263 GCCAATTAATAACCATACAATGG - Intergenic
945346101 2:208718635-208718657 GCTAATTAATAACCCTACAATGG - Intronic
945487229 2:210410970-210410992 GTGAATTAATAACCCTACAATGG - Intergenic
945646799 2:212506301-212506323 GCCAATTAATAACCATACAATGG + Intronic
945712402 2:213315176-213315198 CTTTATTGATTGCCATACACAGG + Intronic
946451396 2:219783095-219783117 CATAATTGTTTGCCATACAAGGG + Intergenic
946667742 2:222068478-222068500 CATAACAAAATACCATACAATGG + Intergenic
947468119 2:230372391-230372413 GTCAATTAATAACCCTACAATGG + Intronic
948993993 2:241569473-241569495 CTTCATTAATAACCAAAGAAAGG - Intronic
1168823959 20:796373-796395 TTTAATTGATTACCATACAAAGG + Intergenic
1171270965 20:23816765-23816787 CTTAATTAATTACTATACAAAGG + Intergenic
1171777685 20:29384843-29384865 CTTAATTAACTAGAATAAAAAGG - Intergenic
1172340885 20:34156525-34156547 CTTAATTAATTACCATACAAAGG + Intergenic
1172818240 20:37707863-37707885 AGTAATTAATAACCCTACAATGG - Intronic
1175127279 20:56761961-56761983 CATAATAAATTACCATAAACTGG + Intergenic
1176769576 21:13056993-13057015 TTTAACTGATTACCATACAAAGG + Intergenic
1176946053 21:14983057-14983079 ATCAATTAATAACCCTACAATGG + Intronic
1177094099 21:16809677-16809699 CTTCATTAAATACCAAAGAATGG - Intergenic
1177649925 21:23947504-23947526 CTTAATTCATTAATATACAAAGG - Intergenic
1177806339 21:25878696-25878718 CTTAATTATTTACTAAACAAGGG - Intergenic
1178105396 21:29313299-29313321 TCTAATTAATTGCCATACATTGG + Intronic
1178109541 21:29356598-29356620 CTTAATTAATTACCATACAAAGG - Intronic
1178246562 21:30958546-30958568 CTTAATCAACTACCACAGAATGG + Intergenic
1180434473 22:15287130-15287152 TTTAACTGATTACCATACAAAGG + Intergenic
1180516677 22:16150937-16150959 CTTAACTGATTACCATACAAAGG + Intergenic
1182514327 22:30844908-30844930 GCCAATTAATAACCATACAAAGG - Intronic
1183943754 22:41311921-41311943 GTTAATTAAATTCCATACCATGG - Intronic
949610167 3:5696116-5696138 TTTAATTAATTACCATACAAAGG - Intergenic
949611364 3:5707001-5707023 CTTAATTAATTACCATACAAAGG - Intergenic
949823519 3:8140304-8140326 CATGATTAATTACCATGGAATGG - Intergenic
950562123 3:13737464-13737486 ACTAATTAATAACCCTACAATGG + Intergenic
950594772 3:13970041-13970063 TTTAATTGATTACCATACAAAGG - Intronic
951020970 3:17780502-17780524 CTTAATTAATTACCATACAAAGG + Intronic
951373320 3:21880608-21880630 TTTAATTACTAACCCTACAATGG + Intronic
952554840 3:34520275-34520297 CTTAATTAATTGCCATACAAAGG - Intergenic
953496625 3:43393189-43393211 GTTAATTTATTAACATCCAAGGG - Intronic
954599264 3:51855080-51855102 CTTAATTAATTACCATACAAAGG + Intergenic
956244232 3:67163461-67163483 CTTAATAAACTAGCATAGAAGGG - Intergenic
956517774 3:70068562-70068584 CTTGATTAATTGCCATACACAGG - Intergenic
956828701 3:73023817-73023839 TTTAATTCCTTAACATACAAAGG - Intronic
956842612 3:73154565-73154587 CTTAATTAATTACCATACAAAGG - Intergenic
957087519 3:75695908-75695930 CTTAATTAATTAGAAGAAAAAGG + Intergenic
957175394 3:76801877-76801899 GCTAATTAATAACCCTACAAAGG - Intronic
957629314 3:82698179-82698201 CATAATAAAATACCATACACTGG + Intergenic
957645264 3:82914054-82914076 GTCAATTAATAACCTTACAATGG + Intergenic
957689292 3:83546495-83546517 TATAATTAATTACCACACATTGG - Intergenic
957729013 3:84107685-84107707 CTTCATAAAATACCATTCAAAGG - Intergenic
958601566 3:96301533-96301555 CTTAATTAATTACCAAACAAAGG + Intergenic
958666855 3:97151338-97151360 CTTAATTCTGTACCAAACAATGG + Intronic
960354792 3:116637933-116637955 CTGTATTAACTACTATACAACGG + Intronic
960650351 3:119941345-119941367 CTTAGTAAATTATCAAACAAGGG - Intronic
960659408 3:120041690-120041712 TTTAATTGATTACCATACAAAGG + Intronic
960669062 3:120139333-120139355 GTCAATTAATCACCCTACAATGG + Intergenic
960720522 3:120621071-120621093 CGTAATTAATTACCATACAAAGG - Intergenic
961733175 3:128982716-128982738 GTCAATTAATAACCTTACAATGG - Intronic
961839161 3:129694191-129694213 CTTTATTATTTACTATACTAAGG - Intronic
962117655 3:132528991-132529013 CTTAACTATTCACCATAAAATGG - Intronic
963524071 3:146394183-146394205 CTAAATTAATGACCAAAAAATGG - Intronic
963697205 3:148576585-148576607 CTTAATTAATTACCATACCAAGG + Intergenic
963991832 3:151665105-151665127 CTTAATTAATTACCATACAAAGG - Intergenic
964398814 3:156277068-156277090 CCCAATTAATTACCCTACAATGG - Intronic
964972464 3:162578602-162578624 CTTAATTAATTACTATACAAAGG + Intergenic
965227003 3:166002610-166002632 CTCAATTAATTTAAATACAATGG - Intergenic
965731401 3:171775867-171775889 ATTAATTAATTAAAATAAAAGGG + Intronic
965873431 3:173287640-173287662 CTTAATTAATAACCACCCAGAGG - Intergenic
966717404 3:183027291-183027313 ACTAATTAATAACCCTACAATGG + Intronic
967494405 3:190126937-190126959 CTTAATTCATTTCTACACAAGGG + Intergenic
967623347 3:191660468-191660490 AAGACTTAATTACCATACAAAGG + Intergenic
970363173 4:15330695-15330717 CAAACTTAATTACCTTACAAAGG + Intergenic
970900316 4:21151364-21151386 ATTAACTAAATACCATAGAATGG + Intronic
971583748 4:28377621-28377643 CTTAATTAATAGCAATACAGTGG - Intronic
972651309 4:41020292-41020314 CTTAACTAATTACCATACAAAGG + Intronic
972776226 4:42243468-42243490 TCTAATTAATAACCCTACAATGG + Intergenic
972889645 4:43540906-43540928 CTTAATGAATTACATTTCAAAGG + Intergenic
973000707 4:44945684-44945706 ATCAATTAATAACCCTACAATGG + Intergenic
973610215 4:52629313-52629335 TTTCATAAATTACCATTCAAAGG + Intronic
973887800 4:55340352-55340374 CTTAATTAATTACTGTACAAAGG + Intergenic
974079983 4:57202180-57202202 GTTAGTTAATTGCCTTACAATGG + Intergenic
974471639 4:62326250-62326272 GTCAATTAATTACCCTGCAATGG + Intergenic
974599831 4:64063879-64063901 ATTAATTACTTAACATACAGAGG + Intergenic
976829518 4:89298575-89298597 CTCAAATAATTCCCAGACAACGG - Intronic
977134723 4:93289487-93289509 CCTAATTAACTATTATACAATGG - Intronic
977145542 4:93435268-93435290 CCTAATTAATAACCATTCAATGG + Intronic
977434972 4:96982832-96982854 GTCAATTAATAACCCTACAATGG - Intergenic
977735724 4:100413156-100413178 GTTAATTAATGAGCATAGAAGGG - Intronic
977834479 4:101632516-101632538 CTTAATTAATTACCATACAAAGG - Intronic
977992472 4:103461210-103461232 GCTAATTAATAACCCTACAAGGG - Intergenic
978314003 4:107415834-107415856 CTTAATTAATTACCATACAAAGG + Intergenic
979437704 4:120713770-120713792 CGTAATAAAATACCATACACTGG + Intronic
979448840 4:120844680-120844702 GTCAATTAATAACCCTACAATGG + Intronic
980283132 4:130747179-130747201 CTTAATTAAATTCTATACAGTGG + Intergenic
980438971 4:132816681-132816703 CTTAATTAATTACCGTACAAAGG - Intergenic
981216054 4:142169204-142169226 ATTAAATAATTACCATTTAAAGG + Intronic
982644760 4:158009597-158009619 CTTGATTATATACCAAACAAGGG + Intergenic
982645323 4:158016846-158016868 CTTGAATAATTACTATACAGTGG - Intergenic
982895672 4:160920671-160920693 CTCAAATAATAACCATAAAAAGG + Intergenic
982975013 4:162045218-162045240 GCCAATTAATAACCATACAATGG - Intronic
985169578 4:187134424-187134446 TTTAACTTATTACCATACCATGG + Intergenic
986327798 5:6690576-6690598 AATAATTAATTACAAGACAAAGG + Intergenic
987237951 5:15962152-15962174 GTTCATTAATAACCTTACAATGG + Intergenic
987931039 5:24399506-24399528 CTTAACTAATTACCATACAAAGG + Intergenic
988358231 5:30203496-30203518 CTTAACTAATCACCATACAAAGG + Intergenic
989613762 5:43319384-43319406 TTTAATTGATTACCATACAAAGG - Intergenic
989964160 5:50449501-50449523 CTTAATTAATTACCATACAAAGG - Intergenic
990117055 5:52402285-52402307 CTTAATTAATTACCATACAATGG + Intergenic
990367545 5:55086272-55086294 CTTAATTAATTACCATACAAAGG - Intergenic
990419370 5:55616428-55616450 CTTAGTTAATTACTATACAAAGG + Intergenic
992455651 5:76913248-76913270 CTTAACTAATTACCATACAAAGG + Intronic
992618130 5:78565196-78565218 CTTTATGAATGACCATAAAAAGG + Intronic
993055355 5:82974166-82974188 CTTAATTGATTACCATACAAAGG - Intergenic
993599611 5:89904740-89904762 TTTAATTAATAAACATAAAAAGG + Intergenic
995446438 5:112249360-112249382 CTTAATTACTGATCATGCAAAGG + Intronic
995949397 5:117691396-117691418 CTTAATAAATTAACATGTAAAGG + Intergenic
996098903 5:119427912-119427934 CTTAATTAATTACCATACAAAGG - Intergenic
996380231 5:122855819-122855841 GTAAATTAATAACCCTACAATGG - Intronic
996545817 5:124677978-124678000 GTAAATTAATTACCATATATTGG - Intronic
996674923 5:126163368-126163390 TTTAATTAATTGCCATAAATAGG - Intergenic
998915395 5:147006066-147006088 CTTAATTAATTACCATACAAAGG + Intronic
999801195 5:155038731-155038753 GCTAATTAATAACCCTACAATGG - Intergenic
1000203365 5:159033687-159033709 ATTAATTATTTACCAGCCAATGG - Intronic
1000657486 5:163898350-163898372 GTCAATTAATAACCATACAATGG + Intergenic
1000820764 5:165980576-165980598 GTTAATTAATTACCCTGGAATGG + Intergenic
1000912616 5:167040659-167040681 CTAAATGAATTACCATGCAAAGG + Intergenic
1001558607 5:172654441-172654463 CTTAATTAATTACCACGCAAAGG - Intronic
1002406154 5:179033845-179033867 CTTAAGTTATTACCATGAAATGG + Exonic
1002942245 6:1727919-1727941 ATTAATTAATTAACACAAAAAGG + Intronic
1003404033 6:5813976-5813998 GCTAATTAATAACCCTACAATGG - Intergenic
1003805995 6:9726430-9726452 CTTAATTAATTACCATACAAAGG + Intronic
1005302807 6:24487450-24487472 CTTCATTAAGTACCAAACAAAGG - Intronic
1005780033 6:29181237-29181259 CCTAATTAATAAACATAGAAGGG - Intergenic
1006222043 6:32499424-32499446 CTTAACTAATTAATATACAAAGG + Intergenic
1007355959 6:41317837-41317859 CTGAATTAATTACCACACATAGG + Intergenic
1008168971 6:48179003-48179025 ACTAATTAATTACCAAAAAAAGG - Intergenic
1009312438 6:62171086-62171108 CTTAATTAGTTCCCCAACAATGG + Intronic
1009919898 6:70044557-70044579 GTCAATTAATAACCATACAATGG - Intronic
1010075276 6:71790634-71790656 TTTAATTAATTACCATACAAAGG + Intergenic
1011252856 6:85391640-85391662 CATTATTTATTACCATACTAGGG - Intergenic
1011450021 6:87482681-87482703 CTTAATTAATTACCATATAAAGG - Intronic
1011771251 6:90675751-90675773 CTTCATTAATTACAATGCACTGG - Intergenic
1012119457 6:95345904-95345926 TTCAATTAATAACCATACAATGG - Intergenic
1012441084 6:99262997-99263019 CTTAATTAATTACCATACAAAGG - Intergenic
1012686405 6:102256008-102256030 CTTCATTCATTTCCCTACAAAGG + Intergenic
1013684861 6:112567724-112567746 TTTAAATAATCACCATACAATGG + Intergenic
1013977620 6:116095140-116095162 CTTAATTAATTACCATCCAAAGG + Intergenic
1015018130 6:128438794-128438816 CTGAATTAATCACCAAATAATGG + Intronic
1015746517 6:136515557-136515579 GTTAACTAATAACCTTACAATGG - Intronic
1016695491 6:146989642-146989664 CTTAAATGAGTACTATACAAAGG + Intergenic
1018258550 6:161946813-161946835 CTAAATAAATTACAGTACAATGG + Intronic
1018592993 6:165447876-165447898 CGTAATTTGTTACAATACAAGGG + Intronic
1019600000 7:1876516-1876538 CTAAATTAATTACGATACCTTGG + Intronic
1019636627 7:2079416-2079438 CTGAAATAATTACCAATCAAAGG + Intronic
1020509085 7:9030094-9030116 CTTAATTAAATTTCAAACAATGG - Intergenic
1020570671 7:9857031-9857053 GTCAATTAATAACCCTACAATGG - Intergenic
1020727664 7:11835941-11835963 GCTAATTAATAACCCTACAATGG + Intergenic
1021333580 7:19369822-19369844 CTAAACTAATTACCATGAAAGGG + Intergenic
1021356143 7:19655179-19655201 CTTAATTAATTACCATACAAAGG - Intergenic
1021602334 7:22376798-22376820 TTTAATTAATAACAATATAAAGG - Intergenic
1021654535 7:22862279-22862301 CTTAATGAAGAACCATATAAAGG + Intergenic
1021756277 7:23856176-23856198 CTTAATTAATTACCATACAAAGG - Intergenic
1022424716 7:30257398-30257420 GACAATTAATAACCATACAATGG + Intergenic
1023077758 7:36500680-36500702 CTTAACTAATAACCATACAAAGG - Intergenic
1023508679 7:40926815-40926837 CATAACAAATTACCATACACTGG - Intergenic
1023798472 7:43813138-43813160 CTCAATTAATTACTATAAAAAGG + Intergenic
1024494409 7:50027785-50027807 CTTAATTTATTGGCCTACAATGG - Intronic
1024977650 7:55128583-55128605 CATTATTAATTACTATGCAAGGG - Intronic
1025798259 7:64759894-64759916 CTTAACTAATTACCATACAAAGG - Intergenic
1026377645 7:69767974-69767996 CTGAAGTAATTACAATACACTGG - Intronic
1027346520 7:77265602-77265624 CTAGATTAAGTACCATAGAAGGG + Intronic
1027435552 7:78160295-78160317 GGTAATCAATTACCTTACAAGGG + Intronic
1027447056 7:78286345-78286367 CTGAATATTTTACCATACAAAGG + Intronic
1027623136 7:80517569-80517591 GTCAATTAATAACCCTACAATGG - Intronic
1028461360 7:91096711-91096733 CTTTATTAATTAACATTAAAAGG + Intronic
1028793587 7:94879705-94879727 CTTAATTAATTACTATACAAAGG + Intergenic
1029167821 7:98607034-98607056 CATAATTTATTGCCATCCAATGG + Intergenic
1029854563 7:103502207-103502229 CTTATTCAATTAACATACTAAGG - Intronic
1031215211 7:118881631-118881653 GCTAATTAATAACCTTACAATGG + Intergenic
1031654860 7:124342206-124342228 CCCAATTAATAACCCTACAATGG - Intergenic
1031732237 7:125313821-125313843 CTTAATTAATTACCATACAAAGG + Intergenic
1032769934 7:135041673-135041695 ATCAATTCATTACCATCCAATGG - Intronic
1033097761 7:138445766-138445788 TTTAATTGATTACCATACAAAGG - Intergenic
1033153732 7:138938403-138938425 CTTAATTTATTTCCATTCACTGG + Intronic
1034133676 7:148744653-148744675 CTTAATTCTTTAAAATACAAAGG - Intronic
1034579442 7:152029821-152029843 CTTAACTAACTACCATACAAAGG - Intronic
1034999221 7:155598358-155598380 CTTGATTAATTGCATTACAAAGG - Intergenic
1035200549 7:157261885-157261907 CATAATTAAATACAGTACAACGG - Intronic
1036142171 8:6218633-6218655 CTTAATTAATTCCCAGACTTGGG + Intergenic
1036998681 8:13690713-13690735 CTTACATAATTGCTATACAAAGG - Intergenic
1037044257 8:14277524-14277546 ATTAATTGATTACAATAAAAAGG - Intronic
1037110149 8:15156191-15156213 CTCAATTAATTACTTTAAAATGG + Intronic
1037393043 8:18414835-18414857 CTTATTTACTTGCCAGACAAGGG - Intergenic
1039076788 8:33697710-33697732 GTTAATTGATAACCCTACAATGG - Intergenic
1039276408 8:35937720-35937742 CTTAATTAATTATCATACAAAGG + Intergenic
1040821899 8:51569301-51569323 TCTAATTAATTTCCATTCAATGG + Intronic
1041770045 8:61463532-61463554 GTTAATTAATAACCTTACAATGG - Intronic
1042088091 8:65130660-65130682 CTTAACCAGTTACCATACAGAGG - Intergenic
1043067885 8:75599546-75599568 CTTATATATTTACCACACAAAGG + Intergenic
1043191967 8:77236467-77236489 CCTAATTTATTACTAGACAATGG - Intergenic
1043859139 8:85295662-85295684 TTTAATTATTTACCAGACATGGG + Intergenic
1044184823 8:89238987-89239009 CTTAATTAATTACCATATAAAGG - Intergenic
1045150084 8:99396095-99396117 CATAATTAATTATCATCCCACGG - Intronic
1045487482 8:102643401-102643423 CCCAAATAATTACCATACATAGG + Intergenic
1046620440 8:116523726-116523748 GTTTATTAATGACCCTACAAAGG + Intergenic
1046927670 8:119809635-119809657 GTCAATTAATAACCCTACAATGG - Intronic
1048166028 8:132062095-132062117 CTTAATTAATATCCACGCAAGGG + Intronic
1049877490 8:145034720-145034742 CTAAATTAATTACCATACAAAGG + Intergenic
1051616033 9:19007820-19007842 CTTAATTTATTACCTTGAAATGG - Intronic
1051817798 9:21130343-21130365 CTAAACTAATTACCACCCAAAGG + Intergenic
1052289959 9:26829264-26829286 CTTAATTAATTACCACACAAAGG + Intergenic
1052302707 9:26972085-26972107 TCTAATTGATTACCATACAAAGG - Intronic
1053479494 9:38405436-38405458 CTTAATTAATTAAAATATCATGG + Intergenic
1053578567 9:39378933-39378955 CTCAATAAATTACCTTAAAATGG + Intergenic
1053843091 9:42207012-42207034 CTCAATAAATTACCTTAAAATGG + Intergenic
1054100150 9:60937738-60937760 CTCAATAAATTACCTTAAAATGG + Intergenic
1054121547 9:61213365-61213387 CTCAATAAATTACCTTAAAATGG + Intergenic
1054586194 9:66969147-66969169 CTCAATAAATTACCTTAAAATGG - Intergenic
1055151262 9:73003494-73003516 ATTAATTATTTACCCTTCAAGGG + Intronic
1055457974 9:76490841-76490863 CTTAACTAATTATCATACAAAGG - Intronic
1055812823 9:80169900-80169922 GCTAATTAATAACCCTACAATGG - Intergenic
1056414619 9:86364477-86364499 TTTAATTGATTACCATACAAAGG - Intergenic
1056734188 9:89191461-89191483 CTTCATTCATTACCATACATTGG - Intergenic
1056747303 9:89314215-89314237 TTTACTCAATTACCATAAAAAGG - Intronic
1057044089 9:91871399-91871421 ATTAATTAATCACCCTACAGTGG + Intronic
1057370831 9:94471575-94471597 GCCAATTAATTACCTTACAATGG + Intergenic
1057544169 9:96004878-96004900 CTGAATTGATTACCATAAAAAGG + Intronic
1059943974 9:119387116-119387138 CTAAATTAATTATAATACAAGGG + Intergenic
1060991486 9:127852119-127852141 GTTAATAAATTACCACACGACGG - Intronic
1061851078 9:133416032-133416054 CTTTATAAATTACCAAACACAGG - Intronic
1185493880 X:539667-539689 TTTAAATAATTACCCTTCAAGGG + Intergenic
1186199371 X:7141097-7141119 GCTAATTAATAACCCTACAATGG + Intronic
1187109965 X:16287430-16287452 GTTAATTAATCACAATAAAAAGG + Intergenic
1188136960 X:26503304-26503326 CTTAATTAATTACCATACAAAGG + Intergenic
1188540565 X:31245879-31245901 GGTAATTAATAACCCTACAATGG + Intronic
1189034395 X:37480703-37480725 CTTAATTAATTACCATACAAAGG + Intronic
1189930851 X:46008254-46008276 GTTAATTAATAACCATACAATGG - Intergenic
1191798255 X:65046834-65046856 GATAATTAATAACCCTACAATGG - Intergenic
1191815412 X:65239538-65239560 CCTAATTAAATAACATAGAATGG - Intergenic
1192482317 X:71496227-71496249 CTTAATTAATTACCACACAAAGG - Intronic
1192689063 X:73341507-73341529 CTTAACTAGTTACCATTCTATGG - Intergenic
1193342987 X:80373478-80373500 GCTAATTAATAACCCTACAATGG - Intronic
1194306126 X:92251262-92251284 CATAATTAATTATTATACACTGG + Intronic
1195272251 X:103243242-103243264 CTTCATTAATAACCAGAGAAGGG - Intergenic
1195281086 X:103333657-103333679 TTTAATAAATTAACATACAGTGG + Intergenic
1195850722 X:109279142-109279164 CCTAATTAATTACCATACAAAGG - Intergenic
1196126924 X:112110892-112110914 CTTAATTAATTACCATACAAAGG - Intergenic
1196391099 X:115208282-115208304 CTCAGTTAATTAGCATCCAAAGG + Intronic
1196651159 X:118169660-118169682 CTTAATTATTTACCACCTAAGGG - Intergenic
1197087157 X:122492419-122492441 CCTAATTAATTGCCATAGAGAGG + Intergenic
1197299777 X:124763955-124763977 CTTGATTATTTAACATATAATGG + Intronic
1198162850 X:134024771-134024793 CTGAATTAATTTCCCTACACTGG + Intergenic
1198742302 X:139853980-139854002 CTTAATTAATTACCACACAAAGG + Intronic
1199278392 X:145972088-145972110 CTTAATTAATTACTATAGAAAGG + Intergenic
1199637605 X:149828168-149828190 CTTAATTAATTACCATACAAAGG + Intergenic
1200694683 Y:6348484-6348506 CTTAACTAATTACCATACAAAGG - Intergenic
1200763443 Y:7060943-7060965 CTTAATTAATTACCATAGAAAGG - Intronic
1200945507 Y:8831433-8831455 TTTAACTAATTACCATACAAAGG + Intergenic
1201040594 Y:9826226-9826248 CTTAACTAATTACCATACAAAGG + Intergenic
1201271765 Y:12262614-12262636 CTTAACTAATTACCATACAAAGG - Intergenic
1201297322 Y:12475020-12475042 CTTAAATAATTACCATATAAAGG - Intergenic
1201648577 Y:16261974-16261996 CTTAACTAATTACCATACAAAGG - Intergenic
1201654233 Y:16323327-16323349 CTTAACTAATTACCATACAAAGG + Intergenic
1201760633 Y:17533544-17533566 CTTAATTAAATAGAATAAAAAGG - Intergenic
1201840920 Y:18372446-18372468 CTTAATTAAATAGAATAAAAAGG + Intergenic
1201919697 Y:19221093-19221115 ATTAATTAATTACCATACAAAGG + Intergenic
1202089692 Y:21176922-21176944 CTTAATTAATTACCATACAAAGG - Intergenic
1202192211 Y:22257170-22257192 CTTAATTAATTACCATACAAAGG - Intergenic