ID: 1071283291

View in Genome Browser
Species Human (GRCh38)
Location 10:84122669-84122691
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071283285_1071283291 25 Left 1071283285 10:84122621-84122643 CCTGAAGGGAGTTTCTCCTAGGT No data
Right 1071283291 10:84122669-84122691 AATTAAGATTTAGATCCCCTGGG No data
1071283283_1071283291 30 Left 1071283283 10:84122616-84122638 CCTGTCCTGAAGGGAGTTTCTCC No data
Right 1071283291 10:84122669-84122691 AATTAAGATTTAGATCCCCTGGG No data
1071283287_1071283291 9 Left 1071283287 10:84122637-84122659 CCTAGGTCTGGTCAGACCTTTGT 0: 36
1: 91
2: 103
3: 63
4: 147
Right 1071283291 10:84122669-84122691 AATTAAGATTTAGATCCCCTGGG No data
1071283289_1071283291 -7 Left 1071283289 10:84122653-84122675 CCTTTGTATGGTAATTAATTAAG 0: 42
1: 46
2: 27
3: 41
4: 297
Right 1071283291 10:84122669-84122691 AATTAAGATTTAGATCCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071283291 Original CRISPR AATTAAGATTTAGATCCCCT GGG Intergenic
No off target data available for this crispr