ID: 1071283949

View in Genome Browser
Species Human (GRCh38)
Location 10:84127031-84127053
Sequence GAAAGGGCAGAGATGCAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071283949_1071283952 -9 Left 1071283949 10:84127031-84127053 CCTACCTGCATCTCTGCCCTTTC No data
Right 1071283952 10:84127045-84127067 TGCCCTTTCCAGAGAGTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071283949 Original CRISPR GAAAGGGCAGAGATGCAGGT AGG (reversed) Intergenic
No off target data available for this crispr