ID: 1071285862

View in Genome Browser
Species Human (GRCh38)
Location 10:84144465-84144487
Sequence CACCTACAGGAGCCTGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1050
Summary {0: 1, 1: 1, 2: 52, 3: 184, 4: 812}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071285862_1071285868 6 Left 1071285862 10:84144465-84144487 CCTGCCTCAGGCTCCTGTAGGTG 0: 1
1: 1
2: 52
3: 184
4: 812
Right 1071285868 10:84144494-84144516 CAGGCACATGCCACCATGCCCGG 0: 2027
1: 10248
2: 34963
3: 80042
4: 140234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071285862 Original CRISPR CACCTACAGGAGCCTGAGGC AGG (reversed) Intronic
900293738 1:1937770-1937792 CACCTCCCTGAGCCTGAGGGCGG - Intronic
900337553 1:2172109-2172131 CATCTACAGGGACCTGAAGCTGG + Exonic
900405505 1:2491172-2491194 TGCCTGCAGGAGCCAGAGGCCGG - Exonic
900635132 1:3659791-3659813 TAACTCCAGGAGGCTGAGGCAGG - Intronic
900649496 1:3723965-3723987 GGCCTGCAGGAGGCTGAGGCTGG + Intronic
900662510 1:3791998-3792020 GCCCTTCAGGAGGCTGAGGCGGG - Intronic
900940135 1:5793287-5793309 CATCTCCAACAGCCTGAGGCTGG + Intergenic
901042486 1:6373751-6373773 GCCCTTCAGGAGGCTGAGGCAGG + Intronic
901042735 1:6375149-6375171 CGCCTGTAGGAGGCTGAGGCAGG + Intronic
901097987 1:6697914-6697936 CGCCTGTAGGAGGCTGAGGCAGG - Intronic
901167027 1:7228651-7228673 CACCTACAGGGGCCTCGGACCGG + Intronic
901249063 1:7759035-7759057 CAGCTACTGGAGGCTGAGGTGGG + Intronic
901399779 1:9007846-9007868 CAGCTACAGGAGGCGGAGGCAGG - Intronic
901454616 1:9355942-9355964 CACGTACAGGCCCCTGAAGCAGG + Exonic
901480616 1:9522421-9522443 CAGCTACTCGAGGCTGAGGCAGG + Intergenic
901503228 1:9666975-9666997 CAGCTACAGGAGGCTGAGGCAGG - Intronic
901698648 1:11030954-11030976 CACCTTTGGGAGGCTGAGGCGGG + Intronic
901906440 1:12416069-12416091 CAGCTACGGGAGGCTGAGGTAGG + Intronic
902210772 1:14902977-14902999 CTACTTCAGGAGGCTGAGGCAGG - Intronic
902309772 1:15573010-15573032 CACTTTAAGGAGGCTGAGGCGGG + Exonic
903604260 1:24563408-24563430 CTACTTCAGGAGGCTGAGGCAGG + Intronic
903630128 1:24762309-24762331 CTACTTCAGGAGGCTGAGGCAGG + Intronic
903790734 1:25891217-25891239 CAGCTGCAGGAGGCTAAGGCAGG + Intronic
903909366 1:26711218-26711240 CAGCTACGAGAGGCTGAGGCAGG - Intronic
903941465 1:26934769-26934791 CAGCTACTGGAGGCTGAGGCAGG - Intronic
904032832 1:27543829-27543851 CAGCTACAGGAAGCTGAGGCAGG + Intronic
904121823 1:28203584-28203606 AGCTTACAGGAGGCTGAGGCAGG + Intronic
904504985 1:30944984-30945006 CAACTTCGGGAGGCTGAGGCAGG + Intronic
904766583 1:32853358-32853380 CAGCCTCAGGAGGCTGAGGCAGG + Intronic
904854314 1:33485519-33485541 CAGCTACAGGGGGCTGAGGCAGG - Intronic
904928859 1:34070383-34070405 CAGCCACAGGAGCCTGTGGAGGG - Intronic
905413533 1:37788981-37789003 GCACTACAGGAGGCTGAGGCAGG + Intergenic
905656148 1:39687208-39687230 CATCTTCAGGAACCTGAGGCTGG + Intronic
906332513 1:44898802-44898824 CAGCTACAGGAGGCTGAGGCAGG - Intronic
906508715 1:46398643-46398665 CTACTCCAGGAGGCTGAGGCAGG - Intronic
906636178 1:47412180-47412202 AGCCTTCAGGAGCCTCAGGCTGG + Intergenic
906888661 1:49682290-49682312 CAGGTACAGGAGGCTGAGGCAGG + Intronic
906988568 1:50713046-50713068 CAGCTACAGGAGGCTGAGGTGGG + Intronic
907117282 1:51979927-51979949 CAGCTACAGGAGGCTGAGGCAGG + Intronic
907143585 1:52211591-52211613 CAGCCTCAGGAGGCTGAGGCCGG + Intronic
907744475 1:57199070-57199092 TTCCAACAGGAACCTGAGGCTGG + Intronic
907839982 1:58147502-58147524 CAGCTACTCGAGGCTGAGGCAGG + Intronic
908233617 1:62129825-62129847 CAGCTACAGGAGGATGAGGCAGG + Intronic
908300002 1:62753855-62753877 CACCTAGAGGAGCCCGTGCCGGG - Intergenic
909409735 1:75336265-75336287 CACATTCAGGAGGCTGAGGCAGG - Intronic
909623539 1:77691001-77691023 CAGCTATGGGAGGCTGAGGCAGG + Intergenic
909646494 1:77922707-77922729 CAGCTACGGGAGGCTGAGGCAGG - Intronic
909962324 1:81861640-81861662 GCCCTTCAGGAGGCTGAGGCAGG + Intronic
911178990 1:94844366-94844388 CACCTAGAGGAAAGTGAGGCTGG + Intronic
911199283 1:95028317-95028339 CAGCTACTGGAGGCTGAGGTGGG - Intronic
911356458 1:96826936-96826958 CACCTGTAGGAGGCTGAGGCAGG + Intergenic
911612503 1:99972007-99972029 CTACTTCAGGAGGCTGAGGCAGG - Intronic
911704762 1:100998395-100998417 CAGCCTCAGGAGGCTGAGGCAGG + Intronic
912329554 1:108805781-108805803 CACCTACTTGAGGCTGAGGTGGG + Intronic
912353441 1:109036325-109036347 GCACTATAGGAGCCTGAGGCAGG + Intronic
912355955 1:109054233-109054255 CAGCTACAGGAGGCTGAGGCAGG + Intergenic
913249035 1:116896600-116896622 GAACTTCAGGAGGCTGAGGCAGG + Intergenic
914245289 1:145881171-145881193 CAGCTACAGGAGACTGAGGCAGG + Intronic
914789943 1:150868784-150868806 CAGCTACAGGAGGCTGAGGCAGG + Intronic
914878083 1:151526965-151526987 CAGCTGCAGGAGTCTGAGCCAGG - Exonic
914932742 1:151949472-151949494 CAGCCACAGGAGCAGGAGGCTGG + Intergenic
915229362 1:154434193-154434215 CACGCTCAGGAGGCTGAGGCAGG + Intronic
915288091 1:154865564-154865586 CACCTACAGGCCTGTGAGGCAGG + Intronic
916170047 1:161995126-161995148 CACCAACAGCAGCCAGAGGGAGG + Intronic
917812729 1:178675391-178675413 CACCCTCAGGAGGCTGAGGCAGG + Intergenic
917869551 1:179229456-179229478 CAGCGCCAGGAGCCCGAGGCCGG - Exonic
917962235 1:180154603-180154625 CGCCTCCTGGGGCCTGAGGCGGG + Intergenic
918060022 1:181052951-181052973 CAGCTCCTGGAGGCTGAGGCAGG + Intronic
918190574 1:182170180-182170202 CAGCTACAGGAGGCTGAGGTGGG + Intergenic
918299463 1:183189418-183189440 CACCTCTAGGAGGCTAAGGCAGG + Intronic
918991479 1:191702044-191702066 CAGCTTCAGGTGGCTGAGGCAGG + Intergenic
919236742 1:194855323-194855345 CACCTACATTCCCCTGAGGCAGG + Intergenic
919332206 1:196186548-196186570 CAGCTATTGGAGGCTGAGGCAGG - Intergenic
919437916 1:197586668-197586690 TTCCTACTGGAGCCTGAGACAGG + Intronic
919649523 1:200132799-200132821 CACCTCCAGGAGCCTTAGCAAGG + Intronic
919765888 1:201127185-201127207 CACCTTCAGCAGCCTCTGGCCGG + Intergenic
920086858 1:203423740-203423762 CACCTATGGGAGGCTGAGGTGGG + Intergenic
920194390 1:204217180-204217202 CACCTGCAGGGGCCTGATGTGGG - Intergenic
920196792 1:204233284-204233306 CTCCTCCAGGAGGCTTAGGCTGG - Intronic
920199461 1:204250612-204250634 GACCTGCAGGAACATGAGGCCGG + Exonic
920391275 1:205604141-205604163 CAAGTACAAGAGCCTTAGGCTGG + Intronic
920421396 1:205836617-205836639 TACTCACAGGAGGCTGAGGCAGG - Intronic
921003714 1:211070708-211070730 CAGCTACAGGAGGCTGAGACAGG + Intronic
921124491 1:212165000-212165022 CACATACAAGATCCTGAGGTGGG - Intergenic
921209113 1:212877245-212877267 AAACAACAGGAGGCTGAGGCAGG - Intronic
921542684 1:216435660-216435682 GCACTACAGGAGGCTGAGGCAGG - Intergenic
922498110 1:226076538-226076560 CGCCTATAAGAGGCTGAGGCAGG + Intergenic
922912400 1:229228594-229228616 CAGCTTCAGGAGACTGAGGGGGG + Intergenic
923062279 1:230487060-230487082 CACCTTTAGGAGGCCGAGGCGGG + Intergenic
923486028 1:234432193-234432215 GAACTTCAGGAGGCTGAGGCAGG + Intronic
923711426 1:236390439-236390461 CAGCTACAGGAGGCTGAGGCAGG + Intronic
923772007 1:236945801-236945823 CACCTACTTGAGGCTGAGTCAGG + Intergenic
923926189 1:238629838-238629860 CACCTACTGGAGCCTGACATAGG + Intergenic
924621027 1:245660925-245660947 CAGCTACAGGAGGTTGAGGCAGG - Intronic
924634711 1:245774947-245774969 CACCTCCGGGAGGCCGAGGCTGG - Intronic
924692150 1:246362707-246362729 CACCTCCGGGAGGCCGAGGCTGG - Intronic
924724525 1:246656816-246656838 CAGCTACAGGAGGCTAAGGTGGG + Intronic
924788290 1:247220235-247220257 CACCTCCGGGAGGCCGAGGCTGG - Intergenic
924925527 1:248676547-248676569 CACCTCCGGGAGGCCGAGGCTGG - Intergenic
1062854679 10:773982-774004 CCCCTGCAGCAGCCAGAGGCTGG - Intergenic
1063126359 10:3139772-3139794 TAGCTACAGGAGGCTAAGGCGGG - Intronic
1063176701 10:3557241-3557263 CACCTTCTGGAGCAAGAGGCTGG + Intergenic
1063224911 10:4006552-4006574 CCTCTTCAGGAGTCTGAGGCAGG - Intergenic
1063410845 10:5835496-5835518 CAGCTATAGGAGTCTGAGGCAGG - Intronic
1063412798 10:5849671-5849693 CAGCTTCAGGAGACTGAAGCGGG - Intergenic
1064112968 10:12554267-12554289 CAGCTTCGGGAGGCTGAGGCGGG - Intronic
1065514122 10:26507383-26507405 CAGCTACAGGTGGCTGAGGCGGG + Intronic
1065952505 10:30664924-30664946 CAGCTACGGGAGGCTGAGACAGG + Intergenic
1066363794 10:34756565-34756587 CAGCTACTTGAGGCTGAGGCAGG - Intronic
1066373865 10:34839902-34839924 CAGCTACCTGAGGCTGAGGCAGG - Intergenic
1066678511 10:37913743-37913765 CACCAACAAGAACCAGAGGCAGG - Intergenic
1066716583 10:38293077-38293099 AGGCTACAGGAGGCTGAGGCAGG + Intergenic
1067064071 10:43093881-43093903 CACCAGCAGGAGCCTGCGCCTGG - Intronic
1069108565 10:64414134-64414156 CAGCTACAGGAGGCTGAGGCAGG + Intergenic
1069327442 10:67248671-67248693 CACTTTCAGGAGGCTGAGGCTGG - Intronic
1069534830 10:69245456-69245478 CCCCTATGGGAGGCTGAGGCAGG + Intronic
1069865585 10:71500979-71501001 CAGCTACTCGAGGCTGAGGCAGG - Intronic
1069927529 10:71861209-71861231 CAGCTACAGGAGGCTTAGGTGGG + Intergenic
1070291665 10:75120381-75120403 CAGCTACGGGAGGCTGAGGCAGG - Intronic
1070350822 10:75590857-75590879 CAGCTGCAGGAGGCTGAGGCAGG - Intronic
1070553358 10:77509230-77509252 CAGCTACTGGAGGCTGAGGCAGG - Intronic
1071194784 10:83145223-83145245 CAGCTACTGAAGGCTGAGGCAGG + Intergenic
1071285862 10:84144465-84144487 CACCTACAGGAGCCTGAGGCAGG - Intronic
1071535732 10:86428081-86428103 CACTTTTAGGAGGCTGAGGCGGG - Intergenic
1071547820 10:86541687-86541709 CACCTTTGGGAGGCTGAGGCGGG + Intergenic
1071698726 10:87905587-87905609 CAGCTACGGGAGGCTGAGGCAGG - Intronic
1072328271 10:94319979-94320001 CACCCTTAGGAGGCTGAGGCAGG - Intronic
1072454440 10:95563492-95563514 CACCTGTGGGAGGCTGAGGCAGG + Intergenic
1072649473 10:97283308-97283330 CATCTTCAGGAGGCTGAGGTGGG + Intronic
1073158863 10:101372366-101372388 CAGCTACTCGAGGCTGAGGCAGG - Intronic
1073198724 10:101717301-101717323 CAGCTACAGGAGGCTGTGGTGGG - Intergenic
1073246716 10:102095954-102095976 CAGCTACGGGAGGCTGAGGCAGG - Intergenic
1073504170 10:103969078-103969100 CTACTACGGGAGGCTGAGGCAGG - Intronic
1073576444 10:104630132-104630154 GACCTTCAGGAGTCTGAGACAGG - Intergenic
1075152138 10:119943476-119943498 CAGCTACAGGAGGCTGAGGCAGG + Exonic
1075795510 10:125116901-125116923 TGCCTACAGCAGCATGAGGCAGG + Intronic
1076250503 10:128980551-128980573 CACCTGCAGCAGGCTCAGGCTGG + Intergenic
1076611829 10:131730876-131730898 CGCCTTCAGCAGCATGAGGCAGG + Intergenic
1077057603 11:602566-602588 CAGCCTCAGGAGGCTGAGGCAGG + Intronic
1077185872 11:1235085-1235107 CACCTGCAGGAACCGGAGGTGGG + Exonic
1078572109 11:12468225-12468247 CACCTTGAGCAGACTGAGGCAGG + Intronic
1079036937 11:17028069-17028091 CAGCTACAGGAGGCTGAGGCAGG + Intergenic
1079425709 11:20340451-20340473 CTACTCCAGGAGGCTGAGGCAGG + Intergenic
1080007467 11:27424991-27425013 CAACTTTGGGAGCCTGAGGCGGG - Intronic
1080511972 11:32983737-32983759 CACACTCAGGAGGCTGAGGCGGG + Intronic
1080939684 11:36901547-36901569 AACTTTCAGGAGGCTGAGGCAGG - Intergenic
1081089641 11:38847224-38847246 CTACTTCAGGAGGCTGAGGCAGG + Intergenic
1081328783 11:41778872-41778894 CAGCTACGGGAGGCTGAGGCAGG - Intergenic
1081747908 11:45485905-45485927 CACCTCCAGCAGCCTGGGCCTGG + Intergenic
1081974799 11:47226385-47226407 CAGCTACTGGAGGCTGAGCCAGG - Intronic
1082053635 11:47794361-47794383 CAGCCTCAGGAGGCTGAGGCAGG + Intronic
1083283094 11:61639491-61639513 CACCTATAGGAGGCTGAGGCGGG + Intergenic
1083649113 11:64190746-64190768 CACCTTTGGGAGACTGAGGCAGG + Intronic
1084180283 11:67442681-67442703 CACCTTCAGCAGCCTGGGGAGGG - Intronic
1084218226 11:67663091-67663113 CAGCTCCAGCAACCTGAGGCTGG + Exonic
1084605523 11:70169645-70169667 CCCCTCCAGGGGCCTCAGGCAGG + Intronic
1084975835 11:72797555-72797577 CAGCTACTCGAGGCTGAGGCAGG + Intergenic
1085089286 11:73696438-73696460 CACCTTGGGGAGGCTGAGGCGGG - Intronic
1085226269 11:74923963-74923985 GACCCACAGGAGGCTGAGGCAGG - Intronic
1085306144 11:75487135-75487157 TACCTGCAGGAGGCTGGGGCCGG - Intronic
1085394839 11:76202015-76202037 CACTTAAAGGAGCCTGAACCTGG - Intronic
1085709339 11:78814906-78814928 CCACTACACCAGCCTGAGGCAGG + Intronic
1087059042 11:93960655-93960677 CATCCACAGAAGCCAGAGGCAGG - Intergenic
1087253331 11:95927906-95927928 CAGCTTCTGGAGACTGAGGCAGG + Intergenic
1087408287 11:97756818-97756840 CATCTACATGAGCCTGTGGCAGG + Intergenic
1087997330 11:104825753-104825775 CTTCTCCAGGAGACTGAGGCAGG - Intergenic
1088498134 11:110453224-110453246 CTACTCCAGGAGGCTGAGGCAGG + Intronic
1089028306 11:115294925-115294947 CTACTCCAGGAGGCTGAGGCAGG + Intronic
1089037167 11:115406836-115406858 CTACTTCAGGAGGCTGAGGCAGG + Intronic
1089408200 11:118216255-118216277 CAGCTACGGGAGGCTGAGACAGG + Intronic
1089454879 11:118620378-118620400 CAGCTATGGGAGGCTGAGGCAGG + Intronic
1089530807 11:119127965-119127987 CAGCTACAAGAGGCTGAGGCAGG - Intronic
1089677899 11:120102467-120102489 GAGCTAAAGGAGCCTGTGGCTGG + Intergenic
1090285658 11:125496659-125496681 CCTCTACTGGAGGCTGAGGCGGG + Exonic
1090448902 11:126788921-126788943 CATCTACTGGAGTGTGAGGCTGG + Intronic
1091454517 12:596808-596830 CAGCTACAGGAGGCTGAGGTGGG + Intronic
1092151998 12:6255649-6255671 GACCCTCAGGAGGCTGAGGCAGG + Intergenic
1092349278 12:7742397-7742419 CAGCTACAGGAGGCTGAGGCAGG + Intronic
1092393247 12:8100522-8100544 CAGCTTCAGGAGGCTGAGGCAGG - Intergenic
1092822121 12:12362749-12362771 CTACTTCAGGAGGCTGAGGCAGG - Intronic
1092906896 12:13109115-13109137 TACCTGCAGGAGGCTAAGGCAGG - Intronic
1094000503 12:25689013-25689035 CAGCTACTGGGGGCTGAGGCAGG + Intergenic
1094035675 12:26067875-26067897 CGGCTACAGGAGGCTGAGGTAGG - Intronic
1094543859 12:31385798-31385820 CCTGTACAGGAGGCTGAGGCAGG - Exonic
1094624872 12:32113981-32114003 CATCTACAGGTGGCTGACGCAGG - Intronic
1095569831 12:43672186-43672208 CACTTTGAGGAGGCTGAGGCGGG + Intergenic
1095952578 12:47789918-47789940 CACCTGCGGGAGCCAGAGTCAGG + Exonic
1096062363 12:48712508-48712530 CAACTTTAGGAGGCTGAGGCGGG - Intronic
1096170912 12:49469005-49469027 CACCTCTGGGAGGCTGAGGCAGG + Intronic
1096263541 12:50107164-50107186 CACCTCCTGGAGCCAGAGGGTGG - Intronic
1096301497 12:50432022-50432044 CAGCTACTGGAGGCTGAGGCAGG + Intronic
1096337722 12:50769390-50769412 CAGCTACTCGAGGCTGAGGCAGG + Intronic
1096462035 12:51827149-51827171 CTCCCACAGGAGCCTCAGGAAGG + Intergenic
1096532753 12:52252275-52252297 CACCTACAGGCGCCTGCTGGAGG - Intronic
1096537908 12:52287115-52287137 CACCTACAGGCGCCTGCTGGAGG - Exonic
1096540863 12:52306245-52306267 CACCTACAGGCGCCTGCTGGAGG + Exonic
1096542509 12:52315906-52315928 CACCTACAGGCGCCTGCTGGAGG - Exonic
1096545280 12:52334768-52334790 CAGCTACGGGAGGCTGAGGCAGG - Intergenic
1096549375 12:52362264-52362286 CACCTACAGGCGCCTGCTGGAGG - Exonic
1096552186 12:52380376-52380398 CACCTACAGGCGCCTGCTGGAGG - Exonic
1096554685 12:52396025-52396047 CACCTACAGGCGCCTGCTGGAGG - Exonic
1096805703 12:54139922-54139944 TAGCTACGGGAGGCTGAGGCAGG + Intergenic
1096863684 12:54548804-54548826 CTACTCCAGGAGGCTGAGGCAGG + Intergenic
1097129532 12:56801166-56801188 GATCCTCAGGAGCCTGAGGCAGG - Intergenic
1097157440 12:57023191-57023213 AACCTTCAGGGGCCTGAGTCTGG - Intronic
1097871997 12:64610075-64610097 CCCCTACAGGACCCTGGTGCGGG + Intergenic
1098085861 12:66842459-66842481 CACCCAAAGGAAACTGAGGCAGG - Intergenic
1098287632 12:68924061-68924083 GAGCTACGGGAGGCTGAGGCAGG + Intronic
1098339575 12:69438020-69438042 CAGGTACAGGAGGCTGAGGCAGG + Intergenic
1098429637 12:70405814-70405836 CAGCTAGGGGAGGCTGAGGCGGG + Intronic
1098978954 12:76934228-76934250 TACTTATAGGAGGCTGAGGCAGG + Intergenic
1099127261 12:78777789-78777811 CACCTGCAGGACCCTGATGTGGG - Intergenic
1099205647 12:79723123-79723145 CAGCTACAGGAGGTTGAGGTGGG + Intergenic
1099969175 12:89483023-89483045 CAGCTATGGGAGGCTGAGGCAGG - Intronic
1100485567 12:95023043-95023065 CACCTCTAGGAGGCTGAGGTGGG + Intronic
1101000418 12:100352345-100352367 CAACTTCAGGAGGCTGAGCCGGG + Intergenic
1101590937 12:106124761-106124783 GCACTACAGGAGGCTGAGGCAGG + Intronic
1102244699 12:111347951-111347973 CCCCAACAGGAGAGTGAGGCCGG + Exonic
1102260355 12:111439670-111439692 CAGCTACAGGAGGCTGAAGCAGG - Intronic
1102922018 12:116798678-116798700 CAGATTCAGGAGGCTGAGGCGGG - Intronic
1103482957 12:121263078-121263100 CCACTTCAGGAGGCTGAGGCAGG - Intronic
1103489924 12:121309324-121309346 CATATTCAGGAGGCTGAGGCAGG + Intronic
1103509327 12:121463823-121463845 CACTTATGGGAGGCTGAGGCAGG - Intronic
1103548544 12:121719336-121719358 TCCCAACAGGAGGCTGAGGCAGG + Intronic
1103603831 12:122072019-122072041 CAGCTACGGGAGGCTGAGGCAGG + Intergenic
1103614652 12:122144477-122144499 CAGCTACTTGGGCCTGAGGCTGG + Exonic
1103739722 12:123083104-123083126 CAGCTACAGGAGGCTGTGGTGGG + Intronic
1103789680 12:123460770-123460792 CAGCTACAGAAGGCTGAGGCAGG - Intronic
1104457523 12:128927750-128927772 CAACTTCGGGAGGCTGAGGCGGG + Intronic
1104534980 12:129610158-129610180 CTACTTCAGGAGGCTGAGGCAGG + Intronic
1104786076 12:131448624-131448646 CAGGTGCAGGAGCCTCAGGCGGG + Intergenic
1104847458 12:131853721-131853743 CACCTCAGGGAGGCTGAGGCGGG - Intergenic
1105040619 12:132957862-132957884 CAACTACTGGAGGCTGAGGCAGG + Intergenic
1105838812 13:24235336-24235358 TACCTAGAGGAGCCTCAGCCTGG - Intronic
1105966163 13:25386749-25386771 CACCTCTGGGAGGCTGAGGCGGG + Intronic
1106280200 13:28260280-28260302 CAGCTACGTGAGGCTGAGGCAGG + Intronic
1106547663 13:30744513-30744535 CACCTTCAGAAGCCACAGGCAGG + Intronic
1107244110 13:38271875-38271897 CACGTGCAGGAGCCTAAAGCTGG - Intergenic
1107379113 13:39836773-39836795 CTACTCCAGGAGGCTGAGGCAGG - Intergenic
1107496120 13:40927538-40927560 CAGCTACTGGGGCCTGAGACAGG + Intergenic
1107512942 13:41103230-41103252 CAGCTACAGGAGGCTGAGGTGGG + Intergenic
1107644628 13:42481005-42481027 CAGCTTCAGGAGGCTGAGGCAGG + Intergenic
1108002378 13:45916038-45916060 CACCAAGACTAGCCTGAGGCTGG + Intergenic
1108214545 13:48171630-48171652 CAGCTACTCGAGGCTGAGGCAGG - Intergenic
1108540695 13:51442249-51442271 CACCCTCAGGAAGCTGAGGCAGG - Intronic
1108747978 13:53414655-53414677 CTACTCCAGGAGGCTGAGGCAGG + Intergenic
1109379378 13:61539756-61539778 CTACTCCAGGAGGCTGAGGCAGG + Intergenic
1110332013 13:74283969-74283991 CAGCTACGGGAGGCTGAGGTAGG - Intergenic
1111154068 13:84298977-84298999 CAGCTACAGGAGGCTGAGGAAGG - Intergenic
1111250195 13:85591576-85591598 CACTTAAAGGAGGCTGAGGCAGG - Intergenic
1111299686 13:86331758-86331780 CAGCTACAGGAGGCTGAGACAGG - Intergenic
1111548000 13:89769124-89769146 CACCTGCGGGAGGCTGAGGCAGG + Intergenic
1111797810 13:92945606-92945628 CAACTTCAGGAGGCCGAGGCAGG + Intergenic
1112375430 13:98835849-98835871 CAGCTACGGGAGGCTAAGGCAGG - Intronic
1112396411 13:99036651-99036673 CAGCTACGGGAGGCTGAGGCAGG - Intronic
1112472273 13:99699878-99699900 CAGCTACTCGAGGCTGAGGCAGG + Intronic
1112554446 13:100453388-100453410 CTACTACAGGAGGCTGAGGCAGG + Intronic
1112732996 13:102387841-102387863 CAGCTACAGGAGGCTGAGGCAGG - Intronic
1112833265 13:103479491-103479513 CAGCTACTTGAGGCTGAGGCAGG + Intergenic
1112972470 13:105277304-105277326 GAGCTTCAGGAGGCTGAGGCAGG + Intergenic
1112988594 13:105482619-105482641 CAGTTCCAGGAGGCTGAGGCAGG - Intronic
1113715601 13:112504239-112504261 CACCTATGGGAGGCCGAGGCGGG + Intronic
1114287689 14:21260570-21260592 AAACTTCAGGAGGCTGAGGCGGG + Intronic
1114492079 14:23109018-23109040 CACCTGCAGGAGGCTGAGGTAGG - Intergenic
1114618289 14:24080082-24080104 CACAAACAGTAGCCTGAAGCAGG + Intergenic
1115181472 14:30631239-30631261 CAGCTACTTGAGGCTGAGGCAGG + Intronic
1115408547 14:33046860-33046882 CAGCTACTAGAGGCTGAGGCAGG + Intronic
1115679395 14:35719212-35719234 CAGCTACTGGAGGCTGAGTCAGG + Intronic
1116899312 14:50346760-50346782 CAGCTACTGGAGGCTGAGGCAGG - Intronic
1117133588 14:52710315-52710337 CAGCTACTTGAGGCTGAGGCAGG + Intronic
1117182965 14:53211363-53211385 TACTTTCAGGAGGCTGAGGCAGG + Intergenic
1117405862 14:55402812-55402834 CACTTTAGGGAGCCTGAGGCAGG + Intronic
1117827765 14:59721245-59721267 CAGCTACAGCAGCTTGAGGCTGG - Intronic
1117960278 14:61155429-61155451 CTACTCCAGGAGGCTGAGGCAGG + Intergenic
1118172310 14:63399489-63399511 GACCCACAGGAGGCTGAAGCAGG - Intronic
1118273993 14:64369281-64369303 CAGCTACAGGAGGCTGAGGCAGG + Intergenic
1118410327 14:65470801-65470823 GAGCTTCAGGGGCCTGAGGCAGG - Intronic
1118903135 14:70003052-70003074 GACCTAGAGAATCCTGAGGCTGG + Intronic
1118994785 14:70825910-70825932 CAACTAAGGGAGGCTGAGGCGGG + Intergenic
1119043220 14:71294505-71294527 CAGCTACTGGAGGCTGAGGCAGG - Intergenic
1119128321 14:72149024-72149046 CAGCTGGGGGAGCCTGAGGCTGG + Intronic
1119568924 14:75652932-75652954 CTACTCCAGGAGGCTGAGGCAGG - Intronic
1119934413 14:78577709-78577731 CACCTATGGGAGGCCGAGGCGGG - Intronic
1120626396 14:86831880-86831902 CTCCTACAGGGGCTTGAGGTTGG + Intergenic
1120815939 14:88858206-88858228 CACTTTAAGGAGGCTGAGGCGGG - Intronic
1120936048 14:89896276-89896298 CACTCACAGGAGGCCGAGGCAGG + Intronic
1120940076 14:89939488-89939510 CAGCAACAGGAGCAGGAGGCGGG + Intronic
1120958904 14:90106907-90106929 CTACTCCAGGAGGCTGAGGCAGG + Intronic
1121408896 14:93735801-93735823 CAGCCTCAGGAGGCTGAGGCAGG - Intronic
1121541441 14:94729989-94730011 CTCCTAGTGGAGGCTGAGGCAGG - Intergenic
1121738348 14:96234405-96234427 CCCCAGCAGGAGCCTGAGGGAGG - Intronic
1121742709 14:96265324-96265346 CAGCTACAGGAGGCTGAGGTGGG - Intronic
1122496177 14:102157148-102157170 CAGCTACAAGAGGCTGAGGTGGG + Intronic
1122576232 14:102744444-102744466 CAGCTATTGGAGGCTGAGGCAGG - Intergenic
1122700946 14:103588728-103588750 CAGCTACAGGAGGCTGAGGCAGG + Intronic
1122702112 14:103596867-103596889 CACTTTTAGGAGTCTGAGGCAGG + Intronic
1122730220 14:103791231-103791253 CAGCTACAGTAGGCTGAGGCAGG - Intronic
1124111372 15:26792083-26792105 CAGCTACATGAGGCTGAGGCAGG + Intronic
1124139951 15:27068319-27068341 CTGCTGCAGGAGCCTGCGGCTGG + Intronic
1124240862 15:28026714-28026736 CACCTCAGGGAGTCTGAGGCGGG + Intronic
1125149950 15:36520136-36520158 CATCAGCAGGAGGCTGAGGCAGG + Intergenic
1125477241 15:40055532-40055554 CACCTTCAGGAGCATTAGCCTGG + Intergenic
1125531909 15:40419022-40419044 CTACTTCAGGAGGCTGAGGCAGG + Intronic
1125629890 15:41138636-41138658 CAGCTACTTGAGTCTGAGGCAGG + Intergenic
1125914668 15:43474894-43474916 CCCCAACAGCAACCTGAGGCTGG + Intronic
1125917632 15:43503409-43503431 ACACTTCAGGAGCCTGAGGCAGG + Intronic
1126151523 15:45527541-45527563 CACTTACAGGAGGTTGAGGCAGG - Intergenic
1126155582 15:45562798-45562820 CAACTCCAGGAGGCTGAGGTGGG + Intergenic
1126196471 15:45937219-45937241 AAACTACAGGAGGCCGAGGCGGG - Intergenic
1126473581 15:49042914-49042936 CAGCTTCAGGAGGCTGAGGCAGG + Intronic
1126597183 15:50394541-50394563 CTACTCCAGGAGGCTGAGGCAGG + Intergenic
1126625488 15:50682462-50682484 CAGCTACTAGAGGCTGAGGCAGG + Intronic
1126758340 15:51946299-51946321 CAGCCTCAGGAGACTGAGGCAGG - Intronic
1126759564 15:51956935-51956957 CTACTCCAGGAGGCTGAGGCGGG - Intronic
1126836794 15:52675792-52675814 CAGCTACCGAAGGCTGAGGCAGG + Intronic
1127088916 15:55447688-55447710 GAATGACAGGAGCCTGAGGCAGG + Intronic
1127115911 15:55726833-55726855 AACATACAGGAGGCTGAGGCAGG + Intronic
1127431909 15:58919024-58919046 CTACTACAGGAGGCTGAGGCAGG - Intronic
1128194754 15:65742535-65742557 CTACTCCAGGAGGCTGAGGCAGG - Intronic
1128360867 15:66960801-66960823 CCCCCACAGGTGTCTGAGGCAGG - Intergenic
1128565763 15:68699684-68699706 AACCAACAGGTTCCTGAGGCTGG + Intronic
1129014026 15:72450100-72450122 CTGCTACGGGAGGCTGAGGCAGG - Intergenic
1129490583 15:75921547-75921569 CAGCTACTGTAGGCTGAGGCAGG + Intronic
1129602712 15:77009646-77009668 CACCTGCAGGAGCCTCATGCAGG - Intronic
1129697044 15:77746656-77746678 ATCCTACAGGAGGCTCAGGCAGG + Intronic
1129795562 15:78373558-78373580 CAGCTATAGGAGGCTGAGGCAGG - Intergenic
1129972593 15:79792997-79793019 CAGCTACAGGAGGCGGAGGTTGG - Intergenic
1130544735 15:84846874-84846896 CTCCCTCAGGAGGCTGAGGCAGG - Intronic
1130575372 15:85088128-85088150 CTACTTCAGGAACCTGAGGCAGG - Intronic
1130671142 15:85913962-85913984 CAACTCAAGGAGGCTGAGGCAGG - Intergenic
1131098582 15:89671225-89671247 CCCAAACAGGAGCTTGAGGCGGG - Intronic
1131154475 15:90066587-90066609 CAGCTATAGGAGGCTGAGGCAGG - Intronic
1131319100 15:91368982-91369004 CGCCTGTAGGAGGCTGAGGCAGG + Intergenic
1131325227 15:91436944-91436966 ATCCCACAGGAGGCTGAGGCAGG + Intergenic
1131777590 15:95819138-95819160 CTACTTCAGGAGGCTGAGGCAGG + Intergenic
1131796902 15:96028426-96028448 GAACTTCAGGAGGCTGAGGCTGG + Intergenic
1132026091 15:98405531-98405553 CAGCAACAGCAGCCTGGGGCAGG - Intergenic
1132373067 15:101311220-101311242 GTCTTACAGGAGGCTGAGGCAGG - Intronic
1132484333 16:182473-182495 CAACTTCAGGAGGCTGAGGCAGG + Intergenic
1132493784 16:250055-250077 CGCCTATAGGAGGCTGCGGCAGG - Intronic
1132521591 16:392684-392706 AATCTGCAGGAGGCTGAGGCAGG - Intergenic
1132574653 16:658857-658879 CACATGCAGGACCCCGAGGCGGG - Intronic
1132671985 16:1105809-1105831 CACCTAGAGGATCCTGGGGCTGG + Intergenic
1132778728 16:1611384-1611406 CGGCTACAGGAGGCTGAGGGAGG + Intronic
1132782396 16:1634768-1634790 GCCCAACAGGAGCATGAGGCTGG + Intronic
1132807086 16:1779853-1779875 GACCTGCAGGAGCTGGAGGCGGG + Intronic
1132818450 16:1847522-1847544 ATCCTTCAGGAGGCTGAGGCAGG + Intronic
1133159540 16:3901285-3901307 CAGCTTCAGGAGGCTGAGGCTGG + Intergenic
1133788635 16:8992142-8992164 CAACTACAGGAGGCTTAGGTGGG + Intergenic
1134399830 16:13899592-13899614 CAGCTACTGTAGGCTGAGGCAGG + Intergenic
1134975066 16:18564046-18564068 CTACTTCAGGAGGCTGAGGCAGG + Intergenic
1135020467 16:18958537-18958559 CAGCTACAGGAGGCTGAAGCAGG + Intergenic
1135330881 16:21558610-21558632 CAGCTACAGGAGGCTGAGGCAGG - Intergenic
1135666542 16:24340284-24340306 CAGCTATAGGAGGCTGAGGTAGG + Intronic
1135720748 16:24815739-24815761 CAGCTACAGGAGGCTGAGGCAGG + Intronic
1135906523 16:26517104-26517126 CTACTAAAGGAGGCTGAGGCAGG - Intergenic
1136058773 16:27710244-27710266 CACCTACTTGAGGCTGAGCCAGG + Intronic
1136115234 16:28090381-28090403 CAGCTACTCGAGGCTGAGGCAGG - Intergenic
1136182391 16:28562654-28562676 CACTTTAAGGAGGCTGAGGCGGG + Intronic
1136341777 16:29648725-29648747 CAGCTACTCGAGGCTGAGGCAGG - Intergenic
1136401605 16:30022133-30022155 CCACTCCAGGAGGCTGAGGCAGG + Intronic
1136424260 16:30158780-30158802 GAATCACAGGAGCCTGAGGCAGG - Intergenic
1137816691 16:51404872-51404894 CAGCTACTGGAGGCTGAGGCAGG - Intergenic
1138277979 16:55750127-55750149 CTCCTCCAGGTTCCTGAGGCTGG - Intergenic
1138826897 16:60331830-60331852 CTTCTAAAGGGGCCTGAGGCAGG + Intergenic
1138966917 16:62095555-62095577 ATCCTACAGGACTCTGAGGCTGG - Intergenic
1139191354 16:64867131-64867153 CACCTGTAGGAGGCAGAGGCAGG + Intergenic
1139346487 16:66307024-66307046 GACCACCAGGAGCCTGAGGATGG - Intergenic
1139425469 16:66877248-66877270 CAGCTACAGGAGGCTGAGGCAGG - Intergenic
1139509395 16:67418102-67418124 CACTTTAAGGAGGCTGAGGCAGG + Intergenic
1139595069 16:67952675-67952697 CAGCAACTGGAGGCTGAGGCAGG + Intronic
1139688133 16:68620402-68620424 CTACTCCAGGAGGCTGAGGCAGG - Intergenic
1140061483 16:71573925-71573947 CACTTTCAGGAGGCTGAGGTGGG - Intronic
1140114481 16:72029746-72029768 CACACTCAGGAGGCTGAGGCGGG - Intergenic
1140459900 16:75131209-75131231 CACCCTCAGGAGCATGAGGAGGG + Intergenic
1140468247 16:75199307-75199329 CACCTTTGGGAGGCTGAGGCGGG - Intergenic
1140517740 16:75556328-75556350 CACCGAAAGGAGCCAGTGGCGGG + Intergenic
1141195887 16:81860863-81860885 CAGCCTCAGGAGGCTGAGGCAGG + Intronic
1141494834 16:84401333-84401355 CTACTACAGGAGGCTGAGGCAGG - Intronic
1141680883 16:85543098-85543120 CGCCTGTAGGAGGCTGAGGCAGG + Intergenic
1141912678 16:87070776-87070798 CACCTAGAGGAGCCGGAGGAGGG - Intergenic
1143027745 17:3951058-3951080 CCCCTACAGAAGCCTGAGACAGG + Intronic
1143066724 17:4255356-4255378 CTGCTTCAGGAGGCTGAGGCAGG - Intronic
1143082562 17:4392735-4392757 GAACTTCAGGAGGCTGAGGCGGG + Intergenic
1143114304 17:4573643-4573665 CACAACCAGGAGGCTGAGGCAGG - Intergenic
1143259424 17:5586940-5586962 TTCCTTCAGGAGGCTGAGGCAGG + Intronic
1143276106 17:5712083-5712105 CAGCTAGAGGAGCCAGAGGTGGG + Intergenic
1143543898 17:7585288-7585310 CACTTTAAGGAGGCTGAGGCAGG + Intronic
1143559030 17:7681030-7681052 CACTTTTAGGAGGCTGAGGCAGG - Intronic
1143684800 17:8505019-8505041 CTCCTCCTGGGGCCTGAGGCTGG + Intronic
1144042471 17:11424893-11424915 CAGCTACTGGGGGCTGAGGCAGG + Intronic
1144063805 17:11606558-11606580 CTACTTCAGGAGGCTGAGGCAGG - Intronic
1144154937 17:12491298-12491320 CTACTTCAGGAGGCTGAGGCAGG - Intergenic
1144944162 17:18961323-18961345 CCCCTTCAGAAGCCTGGGGCTGG - Intronic
1145235786 17:21207414-21207436 CAGCTACTTGAGACTGAGGCAGG + Intronic
1145269174 17:21395467-21395489 CACCTCTGGGAGGCTGAGGCAGG + Intronic
1145372731 17:22320593-22320615 CAGGTACTGGAGGCTGAGGCAGG + Intergenic
1145926883 17:28654567-28654589 CACTTCCAGGAGGCAGAGGCGGG + Intronic
1146029692 17:29354777-29354799 GAACTTCAGGAGGCTGAGGCAGG + Intergenic
1146182186 17:30705635-30705657 CCTGTCCAGGAGCCTGAGGCAGG + Intergenic
1146189662 17:30753656-30753678 CTACTCCAGGAGGCTGAGGCAGG - Intergenic
1146300147 17:31682128-31682150 CGGCCACAGGAGGCTGAGGCAGG - Intergenic
1146819346 17:35972100-35972122 GATCTACACAAGCCTGAGGCTGG - Intergenic
1147055245 17:37829181-37829203 CACATGCAGGAGCCTGAACCCGG + Intergenic
1147511190 17:41070127-41070149 CACCTACAGTAGCCCCATGCAGG + Intergenic
1147840068 17:43365068-43365090 CTACTCCAGGAGCCTGAGGCAGG - Intergenic
1147858625 17:43502534-43502556 CAGCTACTTGAGGCTGAGGCAGG - Intronic
1147960316 17:44163409-44163431 CAGCTTCCGGAGGCTGAGGCAGG - Intergenic
1149293055 17:55235684-55235706 CTCCTCGAGGAGGCTGAGGCAGG - Intergenic
1149375064 17:56035538-56035560 TACCAACAGTAGCCTGAAGCAGG + Intergenic
1149739689 17:59033542-59033564 CCACTACGGGAGGCTGAGGCAGG - Intronic
1149828464 17:59850565-59850587 CAGCTACTCGAGGCTGAGGCAGG + Intergenic
1150048695 17:61937785-61937807 CAGCTACTCGAGGCTGAGGCAGG + Intergenic
1150377411 17:64693335-64693357 CAGCTAGAGGAGGCTGAGGCAGG - Intergenic
1150497421 17:65618827-65618849 CCACTTCAGGAGGCTGAGGCAGG + Intronic
1150649016 17:66997863-66997885 CACCAACAGGAGCATGAGAATGG + Intronic
1151123588 17:71820350-71820372 CACCTGCAAGAGGCGGAGGCAGG + Intergenic
1151183755 17:72348910-72348932 CTACTTCAGGAGGCTGAGGCAGG + Intergenic
1151337981 17:73451390-73451412 CAGCTACTGGAGGCTGAGGCAGG + Intronic
1151464748 17:74277271-74277293 CAGCTACGGGAGGCTGAGGCAGG + Intronic
1151599666 17:75098450-75098472 CAGCTACTCGAGGCTGAGGCAGG + Intronic
1151761783 17:76108258-76108280 CAGCTACAGGAGGCTGAGGTGGG - Intronic
1151856398 17:76725292-76725314 CAGTTACAGGAGGCTGAGGCAGG + Intronic
1152833333 17:82512615-82512637 CAGCTACGGGAGGCTGACGCAGG + Intergenic
1152866397 17:82726338-82726360 CAGTCACAGGAGCCTGAGGGGGG - Intronic
1153052578 18:914102-914124 CTCCTACAGGAGCTTGTGGAAGG + Intergenic
1153303844 18:3614735-3614757 CAGTTTCGGGAGCCTGAGGCGGG + Intronic
1153566697 18:6426131-6426153 CAATTACGGGAGCCTGAGGAAGG + Intergenic
1153643578 18:7175365-7175387 CACCTGCAGCAGACTGAGACAGG - Intergenic
1153893771 18:9541118-9541140 CACTTATGGGAGGCTGAGGCGGG + Intergenic
1154183510 18:12158635-12158657 CAGCTACGGGAGGCTGAGGCAGG - Intergenic
1155285973 18:24289531-24289553 CAGCTACTCGATCCTGAGGCAGG - Intronic
1155293033 18:24360077-24360099 CTACTTCAGGAGGCTGAGGCAGG - Intronic
1155462856 18:26103135-26103157 CAGCTACTTGAGGCTGAGGCAGG - Intergenic
1155775071 18:29751308-29751330 CAGCTATAGGGGCCTGAGGCAGG + Intergenic
1156205698 18:34883421-34883443 CAGCTACAGGAGGCTGAGGTGGG - Intronic
1156299472 18:35823610-35823632 GTCCTACGGGAGGCTGAGGCAGG + Intergenic
1156450306 18:37262883-37262905 CAGCTGCAGCAGCGTGAGGCAGG + Intronic
1156614201 18:38764112-38764134 CACATACAGGAGCATGAAACTGG + Intergenic
1156677014 18:39539608-39539630 TAGCTACAGGAGGCTGAGGCAGG - Intergenic
1156752539 18:40476744-40476766 CAGCTACAGGAGGCTGAGGTGGG - Intergenic
1156994875 18:43452983-43453005 CCCATTCAGGAGGCTGAGGCAGG - Intergenic
1157717060 18:49895034-49895056 CTCCTCCTGCAGCCTGAGGCTGG + Exonic
1157915645 18:51661193-51661215 CTACTCCAGGAGGCTGAGGCAGG + Intergenic
1158144669 18:54298700-54298722 CAGCTACTCGAGGCTGAGGCAGG - Intronic
1158635788 18:59156083-59156105 CACCTTTGGGAGGCTGAGGCAGG + Intronic
1159588344 18:70303677-70303699 CAGCTACAGGAGGCTGAGGCAGG + Intronic
1159736939 18:72112100-72112122 CTACTTCAGGAGGCTGAGGCAGG - Intergenic
1159837597 18:73357774-73357796 AAACTTTAGGAGCCTGAGGCAGG - Intergenic
1160189586 18:76704412-76704434 CACACCCGGGAGCCTGAGGCTGG - Intergenic
1160223458 18:76993436-76993458 CAGCTTCAGGGGGCTGAGGCAGG + Intronic
1160876531 19:1298989-1299011 CAACTTTGGGAGCCTGAGGCAGG + Intronic
1161000168 19:1906737-1906759 CTCCCAAAGGAGGCTGAGGCAGG + Intronic
1161115010 19:2491882-2491904 CACCTCCAGAAGCCAGAGCCTGG + Intergenic
1161320716 19:3639676-3639698 CTCCTAAAGGAGGCTGAGGCAGG - Intronic
1161383470 19:3978689-3978711 CAGCTACAGGAGGCTGAGGCAGG + Intronic
1161394287 19:4037187-4037209 CACCTGCAGGGGCCTGAGGGCGG + Intronic
1161399928 19:4062717-4062739 CTCACACAGGAGCCTGGGGCAGG + Intronic
1161436512 19:4266853-4266875 CACCTGCAGGAGGCTGAGGCAGG + Intronic
1161527487 19:4765774-4765796 CACCTACAGAAGGCTGAAGTAGG + Intergenic
1161603969 19:5204275-5204297 CACCCACAGGAGCCAGAGATAGG - Intronic
1161721605 19:5905665-5905687 CACTTTTAGGAGGCTGAGGCGGG - Intronic
1161748943 19:6080151-6080173 TACTCACAGGAGGCTGAGGCAGG - Intronic
1161910114 19:7187191-7187213 CAGCTACTCGAGGCTGAGGCAGG - Intronic
1161915319 19:7224055-7224077 CAGCTACTGGAGGCTGAGGTGGG - Intronic
1162390555 19:10387192-10387214 CCTGTACAGGAGGCTGAGGCAGG + Intergenic
1162426560 19:10600287-10600309 CAGCAACGGGAGGCTGAGGCAGG + Intergenic
1162461465 19:10816508-10816530 TTCCTAGAGGTGCCTGAGGCGGG - Intronic
1162616149 19:11802063-11802085 CACTTTCAGGAGGCTGAGGCAGG - Intronic
1162955922 19:14097799-14097821 CATCTACAGGGACCTGAAGCCGG - Exonic
1162976646 19:14210167-14210189 CCTGTCCAGGAGCCTGAGGCAGG - Intergenic
1163422921 19:17225062-17225084 CCCAGACAGGAGGCTGAGGCAGG + Intergenic
1163964569 19:20732949-20732971 CAGCTACTTGAGACTGAGGCAGG + Intronic
1164558458 19:29271111-29271133 CAACGACAGGAGCCTGAGTCAGG - Intergenic
1164876868 19:31697051-31697073 CAGCTACAGGAGGCTGAGGCAGG + Intergenic
1164909281 19:31992638-31992660 CACCCACAGGAGCCTAAGCAGGG + Intergenic
1164974543 19:32562092-32562114 CAGCTTCCGGAGGCTGAGGCAGG + Intergenic
1165119606 19:33550722-33550744 GCACTACAGGAGGCTGAGGCAGG + Intergenic
1165341301 19:35214185-35214207 CACGTGCAGGTGCGTGAGGCAGG + Intergenic
1165438783 19:35812161-35812183 CACCTTCAGCTGCATGAGGCTGG + Exonic
1165457584 19:35922686-35922708 CACTTTCGGGAGGCTGAGGCAGG - Intergenic
1165675060 19:37715366-37715388 GCACTACAGGAGGCTGAGGCGGG + Intronic
1165826987 19:38711184-38711206 CTCCTGCATGAGCCTCAGGCCGG + Intronic
1165881082 19:39044178-39044200 CAGCTACACAAGGCTGAGGCAGG + Intergenic
1166168235 19:41007735-41007757 CAGCTACAGGAGGCTGAGGCAGG - Intronic
1166418805 19:42617611-42617633 TATCTGCAGGAGGCTGAGGCAGG + Intronic
1166598643 19:44073653-44073675 CTCACACAGGAGGCTGAGGCAGG - Intronic
1167291339 19:48626700-48626722 CAGCTACAGGAGGGTGAGGCAGG + Intronic
1167499123 19:49835750-49835772 CCCCTACGGTACCCTGAGGCTGG - Exonic
1167867943 19:52343455-52343477 CTACTCCAGGAGGCTGAGGCAGG + Intronic
1168455388 19:56503795-56503817 CAGCTATGGGAGGCTGAGGCGGG - Intergenic
1168605069 19:57752116-57752138 CAGCTCCGGGAGCCCGAGGCGGG - Intronic
1168655554 19:58125115-58125137 CCACTTCAGGAGGCTGAGGCAGG - Intergenic
925350486 2:3197860-3197882 CTCTGAGAGGAGCCTGAGGCAGG + Intronic
925826626 2:7855000-7855022 CAGCTTCGGGAGGCTGAGGCAGG + Intergenic
926024049 2:9524376-9524398 CAGCTAGAGGAGGCTGAGGTGGG + Intronic
926176029 2:10593248-10593270 CTACTCCAGGAGGCTGAGGCAGG - Intronic
926181125 2:10644134-10644156 CAGCTACAGGAGGTTGAGGTAGG + Intronic
926192047 2:10735700-10735722 CTCCTGTAGGAGGCTGAGGCAGG - Intronic
926303918 2:11623775-11623797 CAGCTACTCCAGCCTGAGGCAGG + Intronic
926668227 2:15548529-15548551 CTACTTCAGGAGGCTGAGGCAGG + Intronic
926761608 2:16283308-16283330 CACATACAGGTGCCTGGGCCTGG + Intergenic
927872285 2:26631226-26631248 GCCCTTCAGGAGGCTGAGGCGGG + Intronic
928351347 2:30558484-30558506 CAACTACTCGAGGCTGAGGCTGG + Intronic
929100923 2:38312595-38312617 CAGCTACGGGAGGCTGAGGCAGG + Intronic
929514265 2:42592148-42592170 CAGCTAAGGGAGGCTGAGGCAGG + Intronic
929791587 2:45027150-45027172 CACATCAAGTAGCCTGAGGCTGG + Intergenic
929860497 2:45672913-45672935 CTGCTCCAGGAGGCTGAGGCAGG + Intronic
929928227 2:46232488-46232510 CACTTTCAGGAGGCTGAGGCGGG - Intergenic
929934601 2:46285731-46285753 CTACTCCAGGAGGCTGAGGCAGG - Intergenic
930060704 2:47286100-47286122 CAGCTACAGGAGGCTGAGGCAGG + Intergenic
930291021 2:49492380-49492402 CAGCTACGGGAGGCTGAGGCAGG + Intergenic
930329266 2:49961994-49962016 CACCTGGAGGAGGCCGAGGCAGG + Intronic
930445970 2:51472853-51472875 AAACTTCAGGAGGCTGAGGCAGG - Intergenic
930705418 2:54500655-54500677 CTACTACAGGAGGCTGAGGTGGG - Intronic
930782275 2:55234361-55234383 CAACTACAGGAGGCTGAGGTGGG - Intronic
931682329 2:64761272-64761294 CAGCTACAGGAAGCTGAGGCAGG + Intergenic
932163617 2:69485770-69485792 CAGTTACTGGAGACTGAGGCAGG - Intronic
932229432 2:70070670-70070692 CGCCTGTAGGAGGCTGAGGCAGG + Intergenic
932337015 2:70937364-70937386 CACCTCCTGAGGCCTGAGGCAGG + Intronic
932338277 2:70943435-70943457 CACCTGCAGGAGGCTGGGGGAGG - Intronic
932427955 2:71654977-71654999 CAGCTACAGGAGGCTAAGGTGGG + Intronic
932494049 2:72137862-72137884 CACCTGCAGGCCCCTGAGGCTGG + Intronic
932575532 2:72960487-72960509 AACCATCAGGAGCCTGTGGCGGG - Intronic
932636593 2:73394461-73394483 CAGTTACTGGAGGCTGAGGCAGG - Intronic
932650589 2:73551546-73551568 CAGCTACTCGAGGCTGAGGCAGG - Intronic
932731000 2:74221940-74221962 CACCTATAGGGAGCTGAGGCTGG + Intronic
934711425 2:96516871-96516893 CAGCTACGGGAGTCTGAGGCAGG + Intergenic
934731151 2:96659055-96659077 CGCCTGTAGGAGGCTGAGGCAGG - Intergenic
935541544 2:104354415-104354437 CACCTTCCGGAGAGTGAGGCCGG + Intergenic
935642255 2:105301848-105301870 CAGCCACAGGAAGCTGAGGCAGG - Intronic
935647243 2:105349341-105349363 CAGCTACAGGAGGCTGAAGCAGG - Intergenic
936008090 2:108907842-108907864 CACCTGCAGGAGCCTCACCCCGG + Exonic
936083215 2:109449260-109449282 CACCGAGTGGGGCCTGAGGCTGG - Exonic
936107536 2:109637844-109637866 TCCCTACAAGAGGCTGAGGCAGG + Intergenic
936378098 2:111959739-111959761 GCACTACAGGAGGCTGAGGCAGG - Intronic
937431271 2:121840791-121840813 CAGCTACTGGAAGCTGAGGCAGG - Intergenic
937867143 2:126761001-126761023 CACGTATAGGAGCCTGCTGCAGG - Intergenic
937898055 2:126993586-126993608 CAGCCTCAGGAGGCTGAGGCAGG + Intergenic
938012582 2:127840600-127840622 CACATAAAGAAGCATGAGGCCGG - Intergenic
938398645 2:130969129-130969151 CACTTACATTAGCCTGAAGCTGG + Intronic
938414734 2:131094529-131094551 CACTTATAGGAGGCCGAGGCGGG + Intergenic
938692140 2:133801563-133801585 CACTTAAAGGAGCCTGAGCTGGG + Intergenic
938694231 2:133820977-133820999 CTACTACGGGAGACTGAGGCAGG - Intergenic
938994354 2:136661624-136661646 CCACTTCAGGAGGCTGAGGCAGG - Intergenic
939734981 2:145833084-145833106 CAGCTTCAGGAGGCTGAGGCAGG - Intergenic
939751403 2:146051652-146051674 CAGCTACTGGAGGCTGAGGTAGG + Intergenic
940203708 2:151178936-151178958 CTACTCCAGGAGGCTGAGGCAGG + Intergenic
940367378 2:152863207-152863229 CAACTACCTGAGGCTGAGGCTGG + Intergenic
941050113 2:160723135-160723157 CCCAGACAGGAGGCTGAGGCAGG - Intergenic
942379553 2:175374379-175374401 CAGCTACTGAAGTCTGAGGCAGG - Intergenic
942402022 2:175612889-175612911 CAACTACGGGAGGCTGAGGCAGG - Intergenic
942671336 2:178379058-178379080 CTCCTTCAGGAGGCTGAGGTGGG + Intronic
943145876 2:184044275-184044297 CAGCTATAGGAGGCTGAGGTGGG - Intergenic
944012033 2:194984113-194984135 CACCGACAGAACTCTGAGGCAGG - Intergenic
944606184 2:201353697-201353719 CACCTACAGGAGGCTGAGGCGGG - Intronic
944771621 2:202920264-202920286 CAGCTACAGGAGTCTGAGGCAGG - Intronic
945356698 2:208849149-208849171 GTCCCACAGGAGGCTGAGGCAGG - Intronic
945521549 2:210833707-210833729 CTCCCACAGGAGCTTGATGCAGG - Intergenic
945525145 2:210878845-210878867 CAGTTACAAGAGGCTGAGGCAGG + Intergenic
945588792 2:211701642-211701664 CAGCTACCGGAGGCTGAGGCAGG + Intronic
945691181 2:213038170-213038192 CAGCTACGGGAGGCTGAGGCAGG - Intronic
946250664 2:218409585-218409607 CTACTTCAGGAGGCTGAGGCAGG + Intergenic
946277311 2:218641356-218641378 CAGCTACTCGAGGCTGAGGCAGG - Intronic
946288744 2:218726914-218726936 AGGCTACAGGAGGCTGAGGCAGG - Intronic
946906319 2:224419760-224419782 CAGCTACGGGAGGCTGAGGCAGG + Intergenic
947480664 2:230496940-230496962 CACCTTCAGGAGTTTGAGGAAGG - Intronic
947721762 2:232373969-232373991 CCACTGCAGGAGGCTGAGGCAGG + Intergenic
947730826 2:232430442-232430464 CAGCTACCCGAGGCTGAGGCAGG - Intergenic
948048808 2:234964255-234964277 CACCTTCAGGAGGCTGGGGAGGG + Intronic
948061544 2:235046103-235046125 CATCTGCAGGAGCTGGAGGCCGG - Intronic
1169133694 20:3182683-3182705 CAGCTACAGGAAGCTGAGGTGGG - Intergenic
1169422768 20:5473199-5473221 CACCAACAGGCGCATGTGGCAGG + Intergenic
1169443929 20:5655958-5655980 CTCATTCAGGAGGCTGAGGCAGG + Intergenic
1169546825 20:6659027-6659049 GAACTTCAGGAGGCTGAGGCGGG + Intergenic
1169675443 20:8147982-8148004 CTTCTAAAGGAGGCTGAGGCAGG - Intronic
1170738114 20:19028065-19028087 CACCTGCAAGACCCTGAAGCAGG + Intergenic
1171772846 20:29338816-29338838 TCCATTCAGGAGCCTGAGGCGGG - Intergenic
1171998866 20:31755647-31755669 CAGCTACTAGAGACTGAGGCAGG + Intronic
1172205104 20:33157740-33157762 GCACTCCAGGAGCCTGAGGCAGG + Intergenic
1172300913 20:33849484-33849506 CAGCTACTGGCGGCTGAGGCAGG + Intronic
1172321227 20:33996535-33996557 CAGTTACATGACCCTGAGGCAGG - Intronic
1172473060 20:35215154-35215176 CACCTTTGGGAGGCTGAGGCGGG - Intergenic
1172743517 20:37188278-37188300 CACCTATAGGAGGCTGAGGCAGG - Intronic
1172784000 20:37454070-37454092 CTCCCACTGCAGCCTGAGGCAGG - Intergenic
1173680169 20:44873533-44873555 GGACTACAGGAGGCTGAGGCAGG - Intergenic
1174126890 20:48312935-48312957 CAGCTATGGGAGGCTGAGGCAGG + Intergenic
1174169646 20:48607996-48608018 CAGCTACCGGAGGCTGAGGCAGG + Intergenic
1174456304 20:50651081-50651103 AGCCAACAGGAGGCTGAGGCAGG - Intronic
1174473265 20:50777140-50777162 CAGCTACGGGAAGCTGAGGCAGG - Intergenic
1175325262 20:58121584-58121606 CACACTCAGGAGGCTGAGGCAGG + Intergenic
1175377145 20:58535855-58535877 CAATTCCAGGAGGCTGAGGCAGG - Intergenic
1175777070 20:61660107-61660129 CACCCACAGGTGGCTGCGGCCGG + Intronic
1175852698 20:62102316-62102338 CACAAGCAGGAGCCAGAGGCTGG + Intergenic
1175861473 20:62152368-62152390 CATCTGGAGGAGCCAGAGGCTGG - Intronic
1175895437 20:62333799-62333821 CACCCACATGAGCCAGAGGAAGG + Intronic
1175917884 20:62435555-62435577 CACCTAAAAGAGCCGAAGGCAGG - Intergenic
1175994364 20:62805465-62805487 CACCTGCGGGAGCCCGGGGCGGG + Intronic
1176099400 20:63358153-63358175 CAGCTCCAGGACACTGAGGCTGG + Intronic
1176259649 20:64172856-64172878 CACATGCAGGAGGCCGAGGCAGG - Intronic
1177580258 21:23013100-23013122 CTACTCCAGGAGGCTGAGGCAGG - Intergenic
1177679502 21:24347484-24347506 CATCTATAGGAGGCCGAGGCAGG - Intergenic
1177703097 21:24663700-24663722 CATCTTCCGGAGGCTGAGGCAGG - Intergenic
1178020816 21:28406410-28406432 CAACTACCGGTGGCTGAGGCAGG + Intergenic
1178348769 21:31855252-31855274 CAGCTGCTGGAGCCTGAGGCAGG - Intergenic
1178637270 21:34315054-34315076 CAGCTATAGGAGGCTGAGGCGGG + Intergenic
1178860169 21:36282304-36282326 CAGCTACTTGAGGCTGAGGCAGG + Intronic
1179393454 21:41015127-41015149 CTACTTCAGGAGGCTGAGGCAGG + Intergenic
1179653250 21:42828786-42828808 CACTTAACGGAGGCTGAGGCAGG - Intergenic
1179657574 21:42854659-42854681 CACCTGCAGGGGCCCGACGCCGG + Intronic
1180201288 21:46226022-46226044 ACCCTACAGGAGGCTGAGGCAGG + Intronic
1180684125 22:17651626-17651648 CACTTTGGGGAGCCTGAGGCAGG - Intronic
1180786384 22:18549994-18550016 AGCCGACAGGAGCCTGGGGCGGG + Intergenic
1180946151 22:19694774-19694796 CAGCTTCAGGAGGCTGAGGTGGG - Intergenic
1181589402 22:23874561-23874583 CAGCTACTCGAGACTGAGGCAGG - Intronic
1182203861 22:28602989-28603011 CTACTTCAGGAGGCTGAGGCAGG - Intronic
1182375583 22:29845295-29845317 CTACTTCAGGAGGCTGAGGCAGG - Intergenic
1182594480 22:31408248-31408270 CTCCCTCAGGAGGCTGAGGCAGG - Intronic
1182637473 22:31740170-31740192 CAGCTACAGGAAGCTGAGGCAGG - Intronic
1182706149 22:32281735-32281757 GAACTTCAGGAGGCTGAGGCGGG - Intergenic
1182808239 22:33093938-33093960 GACCAACAGGAGGCTGAGGTAGG - Intergenic
1183345772 22:37306952-37306974 CCCCTCCTGGAGCCTGGGGCTGG + Intronic
1183368081 22:37417659-37417681 AACACACAGAAGCCTGAGGCTGG + Intronic
1183593785 22:38797446-38797468 CAGCTACAGGAGGCTGAGACAGG - Intergenic
1183769546 22:39912304-39912326 TAGCTACAGGAGGCTGAGGCAGG + Intronic
1184171494 22:42762375-42762397 CACTTATAGGAGGCTGAGGCAGG + Intergenic
1184213313 22:43049983-43050005 CTACTCCAGGAGGCTGAGGCAGG + Intronic
1184246905 22:43240466-43240488 CACCTGCATGAGCCTGAGGAAGG - Intronic
1184251594 22:43263475-43263497 CACCCACAGGAAGCTCAGGCAGG + Intronic
1185084279 22:48730272-48730294 TACTTTCAGGAGGCTGAGGCAGG + Intronic
1185263831 22:49886965-49886987 CACCTACTGGAACCTGAAGAAGG + Exonic
1185358101 22:50387170-50387192 CTACTCCGGGAGCCTGAGGCAGG - Intronic
949616133 3:5755763-5755785 CACACACTGGAGCCTGTGGCAGG + Intergenic
950065284 3:10107397-10107419 CAGCTACGGGAGGCTGAGGCAGG - Intronic
950276009 3:11661580-11661602 CTACTCCAGGAGGCTGAGGCAGG - Intronic
950741356 3:15054428-15054450 AAACTCCAGGAGGCTGAGGCAGG + Intronic
951738905 3:25898514-25898536 CAGCTGCGGGAGGCTGAGGCAGG - Intergenic
952282176 3:31934518-31934540 CAGCTTCAGGAGGCTGAGGCAGG - Intronic
952282831 3:31939845-31939867 CAGCTACAGGAGGCTGAGGCAGG - Intronic
952429909 3:33213290-33213312 TAGCTATAGGAGGCTGAGGCAGG + Intronic
952509773 3:34041365-34041387 CAGCTTCAGGAGGCTGAGGCAGG + Intergenic
953135049 3:40175027-40175049 CAGCTACTGGAGGCTGAGGCAGG + Intronic
953328749 3:42034535-42034557 GCCCTTCAGGAGACTGAGGCGGG - Intronic
953408744 3:42675683-42675705 CAGCTACGGGAGACTGAGGCAGG - Intergenic
953836682 3:46352184-46352206 GCCCTTCAGGAGGCTGAGGCAGG + Intergenic
953945692 3:47145504-47145526 TCCCTTCAGGAGCCTGAGGTAGG - Intronic
954246533 3:49336634-49336656 CAGCTACGGGAGACTGAGGCAGG - Intronic
954273509 3:49527408-49527430 CAGCTACAGGAGAATGAGGCAGG + Intronic
954480272 3:50793468-50793490 CACCTACGGGAGGCTGAGGCAGG - Intronic
954549930 3:51472909-51472931 CACTTTTAGGAGGCTGAGGCGGG - Intronic
954561464 3:51560469-51560491 CTACTACAGGAGGCTGAGGAAGG - Intronic
954567824 3:51613651-51613673 CAGCTACGGGAGGCTGAGGCAGG + Intronic
954669497 3:52281449-52281471 CATCTATAGGAGGCTGAGGCAGG - Intronic
954683229 3:52357133-52357155 CACCTCCCGGAGGCTGAGACAGG + Intronic
955390684 3:58520337-58520359 AAGCCACAGGAGACTGAGGCTGG + Intronic
956118447 3:65941901-65941923 CAGCTTCAGGAGGCTGAGGTGGG - Intronic
956506937 3:69951207-69951229 CAGCTACGGGAGGCTGAGGTGGG - Intronic
956799689 3:72745952-72745974 CAGCTACTCGAGGCTGAGGCAGG - Intergenic
956817406 3:72920930-72920952 CTACTTCAGGAGGCTGAGGCAGG - Intronic
957330854 3:78760886-78760908 CACATATGGGAGGCTGAGGCAGG - Intronic
957565285 3:81877454-81877476 TAGCTACAGGAGGCTGAGGCAGG - Intergenic
958786547 3:98602871-98602893 CAGCTTCAGGAGGCTGAAGCAGG + Intergenic
959141558 3:102492412-102492434 CACCTAGTGGATCCTGAGCCAGG + Intergenic
959772963 3:110122017-110122039 GCACTTCAGGAGCCTGAGGCGGG + Intergenic
959943674 3:112105709-112105731 CAGTTACGGGAGGCTGAGGCAGG + Intronic
960467425 3:118014457-118014479 CAGCTACAGGAGGCTGAGGCAGG - Intergenic
960836761 3:121914744-121914766 CACTTACGGGAGGCAGAGGCAGG + Intronic
960877303 3:122309792-122309814 CACATGCCGGAGGCTGAGGCAGG + Intergenic
961205211 3:125076254-125076276 GGCCTGCAGCAGCCTGAGGCAGG - Intergenic
961373834 3:126449498-126449520 CACCTGCAGCAGCCTGGGGCAGG - Intronic
962140110 3:132781367-132781389 CACATACAGGGGCCAGTGGCGGG + Intergenic
962228739 3:133640655-133640677 CAACTTTAGGAGGCTGAGGCAGG - Intronic
962552799 3:136512192-136512214 CAGCTTCAGGAGGCTAAGGCAGG + Intronic
962781891 3:138726937-138726959 GATATACAGGAGTCTGAGGCAGG + Intronic
963037816 3:141047812-141047834 CACCTACAATGGCCTGTGGCAGG + Intergenic
963556314 3:146793009-146793031 CAACTACTGGGGGCTGAGGCAGG - Intergenic
963926608 3:150957768-150957790 CAGCCTCAGGAGGCTGAGGCAGG - Intronic
964203717 3:154147297-154147319 CATCCTCAGGAGGCTGAGGCAGG + Intronic
964484453 3:157173611-157173633 CTACTTCAGGAGGCTGAGGCAGG + Intergenic
964821603 3:160776712-160776734 CAGTTACAGGAGGCTGAGGCAGG - Intronic
965096344 3:164232143-164232165 CAGCTTCAGGAGGCTGAGGCAGG - Intergenic
965179367 3:165382236-165382258 CAGCTACAGGAGGCTAAGGAAGG - Intergenic
965725338 3:171710172-171710194 CAGCTACTCGAGGCTGAGGCAGG - Intronic
965815132 3:172628403-172628425 CAGCTACTGGAGGCTGAGGCAGG + Intergenic
966155827 3:176915369-176915391 GACACTCAGGAGCCTGAGGCAGG + Intergenic
966833755 3:184033230-184033252 CACGTGCCGGAGGCTGAGGCAGG - Intronic
967307250 3:188070830-188070852 CAGCTACAGGAGGCTGAGGCAGG + Intergenic
967613982 3:191542912-191542934 CCACTTCAGGAGACTGAGGCAGG - Intergenic
968158173 3:196400626-196400648 CACCTATAGAAGGCTGAGGTGGG + Intronic
968416874 4:445227-445249 CAACTTTAGGAGGCTGAGGCAGG - Intronic
968519791 4:1030157-1030179 CACCTCCTGGAGGCAGAGGCAGG + Intergenic
968578395 4:1378437-1378459 CAGCTACTCGAGACTGAGGCGGG + Intronic
968780460 4:2576449-2576471 CAGCTTCAGGGGGCTGAGGCAGG + Intronic
968811647 4:2802280-2802302 CAGCTATAGGAGGCTGAGGCAGG + Intronic
969556262 4:7912956-7912978 CTACTCCAGGAGGCTGAGGCAGG - Intronic
969592335 4:8129074-8129096 CCCATCCAGGAACCTGAGGCTGG + Intronic
970445987 4:16123702-16123724 CACCTCTGGGAGCCAGAGGCTGG + Intergenic
970585895 4:17513934-17513956 CAGCTACTGGAGGCTGAGGCTGG - Intergenic
970599234 4:17627715-17627737 CAGGCACAGGAGGCTGAGGCAGG + Exonic
970800009 4:19962053-19962075 CACCTTTAGGAGGCTGAGGCAGG + Intergenic
970862072 4:20715751-20715773 CAGCTTCAGGAGGCTGAGACAGG + Intronic
970888658 4:21016722-21016744 CAGCTACTGGAGGCTGAGGCAGG - Intronic
971675266 4:29618647-29618669 ATCCTTCAGGAGGCTGAGGCGGG + Intergenic
971750277 4:30638244-30638266 CAGCTTCAGGAGGCTGAAGCAGG + Intergenic
971797279 4:31244178-31244200 GAGCTCCAGGAGGCTGAGGCAGG + Intergenic
972544822 4:40070558-40070580 CCACTCCAGGAGGCTGAGGCAGG - Intronic
972808666 4:42558927-42558949 CACTTTCGGGAGGCTGAGGCAGG + Intronic
973036714 4:45416321-45416343 CACCTATAGGGACCTGAGGAAGG - Intergenic
973286857 4:48428026-48428048 CACTTACGGGAGGCTGAGGTGGG + Intergenic
973950220 4:56005311-56005333 GATATTCAGGAGCCTGAGGCAGG + Intronic
973958402 4:56086387-56086409 CACTTTTAGGAGCCTGAGGTAGG - Intergenic
974676257 4:65093178-65093200 AAAGTACAGGAGGCTGAGGCAGG - Intergenic
974676419 4:65095251-65095273 CTACTTCAGGAGGCTGAGGCAGG + Intergenic
974717715 4:65691859-65691881 CAGCTACAGGAGGTTGAGGCAGG + Intergenic
974838160 4:67275185-67275207 CACCTAGTGGATCCTGAGCCAGG + Intergenic
975634092 4:76428764-76428786 CTACTTCAGGAGGCTGAGGCAGG - Intergenic
975811769 4:78177197-78177219 CATTTCCAGGAGGCTGAGGCAGG - Intronic
975939693 4:79627969-79627991 CACTTTTAGGAGGCTGAGGCAGG + Intergenic
976007542 4:80447566-80447588 CAGCTACATGGGACTGAGGCAGG - Intronic
976240653 4:82953100-82953122 CACCTACAGGAGGCTGAGATGGG - Intronic
976460237 4:85302563-85302585 CAATGACAGCAGCCTGAGGCAGG + Intergenic
976586139 4:86799441-86799463 CAGCTACTCGAGGCTGAGGCAGG - Intronic
976610363 4:87024700-87024722 CAGCCTCAGGAGGCTGAGGCAGG - Intronic
976790982 4:88878174-88878196 CAGCTACAGGAGGCTGAGGCAGG + Intronic
977268029 4:94879490-94879512 CTACTCCAGGAGGCTGAGGCAGG + Intronic
977445226 4:97123406-97123428 CTACCTCAGGAGCCTGAGGCAGG - Intergenic
977604689 4:98971778-98971800 CAGCTACATGAGGCTGAGTCAGG - Intergenic
978056540 4:104275625-104275647 CACTTATAGGAGGCTGAGGCAGG + Intergenic
978361845 4:107939047-107939069 CAGCTACTCGAGGCTGAGGCAGG + Intronic
978529654 4:109701206-109701228 CACTTCCAGGAGGCTGAGGCAGG - Intronic
978790614 4:112659977-112659999 CCTCCTCAGGAGCCTGAGGCGGG + Intergenic
979066897 4:116149192-116149214 CCCCATCAGGAGCCTGAGGTGGG - Intergenic
979464822 4:121024027-121024049 CAGCTACAGGAGGCTGAGGCAGG - Intergenic
979929855 4:126617121-126617143 CACATACAGGAGTGTGATGCGGG + Intergenic
980056646 4:128084374-128084396 CACCTCCGGGAGGCCGAGGCTGG + Intronic
980830309 4:138123632-138123654 CACCTAGAGGAGACTCATGCAGG - Intergenic
980843299 4:138293118-138293140 CAGCTACAGGAGGCTGAGGCAGG - Intergenic
981251987 4:142614109-142614131 AACCCACAGGAGGCTGAGGCAGG + Intronic
981830505 4:148994521-148994543 CTACTTCAGGAGGCTGAGGCAGG + Intergenic
981961246 4:150541802-150541824 CACCTATTGCTGCCTGAGGCAGG - Intronic
982239718 4:153287088-153287110 GGCCTTCAGGAGGCTGAGGCAGG - Intronic
983200971 4:164860282-164860304 CTACTCCAGGAGGCTGAGGCAGG + Intergenic
983510071 4:168599650-168599672 TAGCTACTGGAGGCTGAGGCAGG + Intronic
983556674 4:169065254-169065276 CAGCTACAGGAGGCTGAGGCTGG + Intergenic
983653183 4:170053708-170053730 CACACACAGGAGGCTGAGGTGGG - Intergenic
983946760 4:173594945-173594967 CAGCTACAGGAGGATGAGGCAGG - Intergenic
984612788 4:181859129-181859151 CTACTAAAGGAGACTGAGGCAGG + Intergenic
984675304 4:182540473-182540495 CAGCTACGGGAGGCGGAGGCAGG + Intronic
985087000 4:186324315-186324337 CATATGCAGGAGGCTGAGGCAGG + Intergenic
985430395 4:189874024-189874046 CAACTTTAGGAGGCTGAGGCTGG + Intergenic
985720533 5:1486390-1486412 AGGCTCCAGGAGCCTGAGGCTGG + Intronic
985942502 5:3150006-3150028 CACCCATAGGAGCGGGAGGCCGG + Intergenic
986378496 5:7159413-7159435 CAGCTTCAGGAGGCTGAGGCAGG - Intergenic
986433359 5:7703888-7703910 TAGCTACTGGAGGCTGAGGCAGG + Intronic
986723503 5:10577374-10577396 AATCTACGGGAGGCTGAGGCTGG - Intronic
987042881 5:14079307-14079329 CTACTAAAGGAGGCTGAGGCAGG - Intergenic
987335013 5:16891173-16891195 CAGCTACTTGAGGCTGAGGCAGG + Intronic
987962857 5:24832630-24832652 CTACTAAAGGAGGCTGAGGCAGG - Intergenic
988463069 5:31459279-31459301 CAGCTATAGGAGGCTGAAGCAGG + Intronic
988810171 5:34777052-34777074 TACCAGCAGGAGGCTGAGGCAGG + Intronic
989271057 5:39533584-39533606 TACTCTCAGGAGCCTGAGGCAGG - Intergenic
989305421 5:39949613-39949635 CAGCTACGGGAAGCTGAGGCAGG + Intergenic
989511808 5:42296433-42296455 CACCTGTAGGAAGCTGAGGCAGG + Intergenic
991907515 5:71526797-71526819 CAGCTACAGGAGGCTGAGGCAGG - Intronic
992759286 5:79937407-79937429 CATCTACAGGAGGCTGAGGCAGG - Intergenic
992810974 5:80388193-80388215 TAGCTACAGGAGGCTGAGGTGGG + Intergenic
993063670 5:83072757-83072779 AACTTCCAGGAGGCTGAGGCAGG - Intronic
993204302 5:84860897-84860919 CACCAACAGGAGCCTGAGATGGG + Intergenic
993756270 5:91734137-91734159 CTACTTCAGGAGGCTGAGGCAGG - Intergenic
993965132 5:94350996-94351018 ATCCTTCAGGAGGCTGAGGCAGG - Intronic
993987007 5:94609681-94609703 AGCCTACGGGAGGCTGAGGCAGG + Intronic
995133206 5:108652637-108652659 CTACTTCAGGAGGCTGAGGCAGG - Intergenic
995234966 5:109818250-109818272 CAGTTACAGGAGGCTGAGGCAGG - Intronic
995340996 5:111059401-111059423 CAGCTACAGGAGGCTGAGGCAGG - Intergenic
995455363 5:112346335-112346357 CAGCTACAGGAGGCTGAGGCAGG - Intronic
995590119 5:113690614-113690636 CAGTGACAGGAGGCTGAGGCAGG + Intergenic
995861785 5:116648545-116648567 TACTTTCAGGAGGCTGAGGCAGG - Intergenic
996296993 5:121930927-121930949 CTACTACAGGAGGCTGAGGCAGG + Intergenic
996716507 5:126592174-126592196 CCACTTCAGGAGGCTGAGGCGGG - Intronic
997326186 5:133023657-133023679 CAGCTAAAGGAGGCTGAGGCAGG + Intronic
997475824 5:134141875-134141897 CAGCCACAGGCTCCTGAGGCTGG + Intronic
997553363 5:134772911-134772933 CTCCTTCAGGAGGCTGAAGCAGG - Intronic
997739080 5:136237993-136238015 CGCCTCCTGGAGCCCGAGGCTGG + Intronic
998025719 5:138814358-138814380 CACTGACGGGAGGCTGAGGCAGG - Intronic
998106511 5:139472432-139472454 CACCCAAAGGAACCTGAGGCGGG - Intergenic
998221014 5:140279573-140279595 CAGCTACGGGAGGCTGAAGCGGG - Intronic
998336614 5:141377357-141377379 CCTCTTCAGGAGGCTGAGGCAGG + Intronic
998366024 5:141632133-141632155 CTACTCCAGGAGGCTGAGGCAGG - Intronic
998444674 5:142189324-142189346 CAGCTACTAGAGGCTGAGGCGGG + Intergenic
999274736 5:150322209-150322231 CAGCTACAGGAGGTTGAGGTTGG + Intronic
999348858 5:150847912-150847934 CTAATACAGGAGGCTGAGGCAGG - Exonic
1000212767 5:159122942-159122964 GATCTTCAGGAGACTGAGGCAGG + Intergenic
1000445208 5:161310872-161310894 CAGCTACTGGAGGCTGAGGCAGG - Intronic
1000446098 5:161323133-161323155 CAGCTACTAGAGTCTGAGGCAGG - Intronic
1001069250 5:168569936-168569958 CAGTTACAGGAGGCTGAGGCAGG + Intronic
1001206679 5:169769742-169769764 CAGCTCCAGGAGCCTGAGGAGGG + Intronic
1001289886 5:170449489-170449511 AACCTACAGCAGCCTGATTCAGG - Intronic
1001819935 5:174702565-174702587 CAGCTACAGGAGGCTGAGGTGGG - Intergenic
1002020090 5:176358600-176358622 CAGCTACTCGAGGCTGAGGCAGG + Intronic
1002286382 5:178165276-178165298 CGCCTGCGGGAGGCTGAGGCAGG + Intergenic
1002313995 5:178331611-178331633 CACCGACAGGAGGGTGGGGCAGG + Intronic
1002456297 5:179346797-179346819 CACCTAAGGGTGCCCGAGGCTGG + Intergenic
1003118898 6:3304170-3304192 CACAGACCAGAGCCTGAGGCAGG + Intronic
1003480206 6:6524327-6524349 GAGCTTCAGGAGGCTGAGGCGGG + Intergenic
1003498541 6:6685733-6685755 CACCTACAGGCTCCCAAGGCAGG + Intergenic
1003573368 6:7270516-7270538 CAGCTACGGGAGGCTGAGGCAGG + Intronic
1003734128 6:8858273-8858295 TACGTACAGTAGCTTGAGGCTGG - Intergenic
1003898995 6:10635780-10635802 CACCTTCATGAGGCTGAGGCCGG - Intergenic
1004184424 6:13409809-13409831 CTACTCCAGGAGGCTGAGGCAGG + Intronic
1004420519 6:15465337-15465359 CAGCTACAGGAGGCTGAGGTGGG + Intronic
1004516065 6:16323270-16323292 CAGCTTTAGGAGGCTGAGGCGGG + Intronic
1004657870 6:17681959-17681981 CACTTTTAGGAGGCTGAGGCAGG + Intronic
1004727552 6:18325895-18325917 CACCTCTGGGAGGCTGAGGCAGG - Intergenic
1004923187 6:20395712-20395734 CAGCTACTCGAGACTGAGGCAGG + Intergenic
1004994353 6:21173956-21173978 CAGCTACGGAAGGCTGAGGCAGG + Intronic
1005122669 6:22407171-22407193 CTACTCCAGGAGGCTGAGGCAGG + Intergenic
1005597268 6:27391314-27391336 CTACTTCAGGAGGCTGAGGCAGG - Intronic
1005636967 6:27762040-27762062 CAGCTACGGGAGGCTGAGGCAGG - Intergenic
1005935339 6:30516866-30516888 CACACTCAGGAGGCTGAGGCAGG - Intergenic
1006143248 6:31943586-31943608 CTCCTGCAGGGGCCAGAGGCTGG - Intronic
1006907272 6:37541118-37541140 CAGCTACGGGAAGCTGAGGCAGG + Intergenic
1007011739 6:38424948-38424970 CAGCTACGGGAGGCTGAGGCAGG - Intronic
1007119475 6:39368209-39368231 CACCTACAAGGGCCCGATGCAGG - Intronic
1007518658 6:42433909-42433931 CAGCTACGGGAGGCTGAGTCAGG + Intronic
1007518775 6:42435017-42435039 CTACTTCAGGAGGCTGAGGCAGG + Intronic
1007595527 6:43048877-43048899 CAGCTACTGGAGGCTGAGGCAGG - Intronic
1008213494 6:48755659-48755681 CACCTGCAGGAGGCTGAGGCAGG - Intergenic
1009940057 6:70280862-70280884 CACCTGCAGGACCCTGAGCAGGG + Exonic
1010440250 6:75885558-75885580 CAGCTATGGGAGGCTGAGGCAGG - Intronic
1010756485 6:79671335-79671357 CACATACTGGAGGCTGAGGCAGG + Intronic
1010794919 6:80107140-80107162 CACCTGGAAGAGCCTGAGGGTGG + Intronic
1011687594 6:89836199-89836221 CAACTGCTGGAGGCTGAGGCAGG - Intronic
1013031745 6:106340555-106340577 CTGCCTCAGGAGCCTGAGGCAGG - Intergenic
1013323700 6:109022532-109022554 CACCTGTAGGAGGCTGAGGCAGG - Intronic
1014049391 6:116934632-116934654 GAACTTCAGGAGGCTGAGGCAGG - Intergenic
1014174220 6:118314195-118314217 CACCTACACCAGCCTGGGCCAGG + Exonic
1014226107 6:118848808-118848830 CAGCTTCAGGAGGCTGAGACAGG + Intronic
1015956765 6:138606947-138606969 CACTTTCAGGAGGCTGAGGCAGG - Intronic
1016819860 6:148337168-148337190 CAGCTATGGGAGGCTGAGGCTGG - Intronic
1017373458 6:153739184-153739206 CTACTTCAGGAGGCTGAGGCAGG + Intergenic
1017450341 6:154548982-154549004 CAGCTACAGGAGGCTGAGGCAGG - Intergenic
1017688364 6:156936546-156936568 AATCTGCAGGAGGCTGAGGCAGG + Intronic
1017696874 6:157024513-157024535 AAACTTCAGGAGACTGAGGCGGG + Intronic
1017941636 6:159058392-159058414 CAGCTATAGGAGGCTGAGGAAGG - Intergenic
1017943178 6:159071379-159071401 GAACTTCAGGAGGCTGAGGCAGG - Intergenic
1018048669 6:159988399-159988421 CAGCTACGGGAGGCTGAGGCAGG + Intronic
1018318472 6:162581645-162581667 CAGCTACTTGAGGCTGAGGCAGG + Intronic
1018731760 6:166656781-166656803 CACCTACCTGAGCCAGGGGCTGG - Intronic
1018770269 6:166964522-166964544 CAGCTTCAGGAGGCTGAGGCAGG - Intergenic
1019260794 7:80830-80852 CAGCGACAGGAGCCTGGGCCAGG + Intergenic
1019461909 7:1164095-1164117 AATCTGCAGGAGGCTGAGGCAGG - Intergenic
1019660734 7:2222690-2222712 CAGCTTCAGGAGCGGGAGGCCGG - Exonic
1019767045 7:2859141-2859163 CAGCTACAGGAGGCTGAGGCTGG + Intergenic
1019890469 7:3942018-3942040 CAGCTACGGGAGGCTGAGGCAGG - Intronic
1019996355 7:4727054-4727076 CTACTCCAGGAGACTGAGGCAGG - Intronic
1020034564 7:4957231-4957253 CAGCTACTTGAGGCTGAGGCAGG + Intronic
1020138596 7:5599861-5599883 CACCCACAGGAGAGGGAGGCTGG - Intronic
1020230198 7:6312630-6312652 CCACCACAGGAGGCTGAGGCAGG - Intergenic
1020281447 7:6652294-6652316 CACCTTCAGGAGCCTGGTTCTGG + Exonic
1021720668 7:23501459-23501481 CAGCTACGGGAGGCTGAGGCAGG + Intergenic
1021806582 7:24362844-24362866 CAGCTACTTGAGGCTGAGGCAGG - Intergenic
1022168398 7:27796747-27796769 CAGCTACAGTCTCCTGAGGCAGG + Intronic
1022259935 7:28694653-28694675 CTACTTCAGGAGGCTGAGGCAGG - Intronic
1022273291 7:28831466-28831488 CAGCTACTTGAGACTGAGGCGGG - Intergenic
1022497580 7:30862656-30862678 AACCTAATGGAGCCTGAGGTGGG - Intronic
1022545431 7:31183472-31183494 CACCTACTTGAGGCTGAGGTGGG - Intergenic
1023835421 7:44064802-44064824 CACCTTCAGGAGCCTGGGCAGGG - Intronic
1024242999 7:47449717-47449739 CAACTACTGGAGGCTGAGGCAGG - Intronic
1024265532 7:47603445-47603467 CACCTGCGGGAGGCTGAGGCAGG + Intergenic
1025040779 7:55643545-55643567 CAGCTATAGGAGGCTGAGGCAGG - Intergenic
1025070266 7:55892164-55892186 CAGCTACAGGAGGCTGAGGCTGG + Intronic
1025970032 7:66314399-66314421 CAGCTGCAGGAGGCTGAGGTGGG + Intronic
1026150014 7:67779973-67779995 CAGCTACAGGAGGCTGAGGTGGG + Intergenic
1026329817 7:69342121-69342143 CCCATTCAGGAGGCTGAGGCAGG - Intergenic
1026739372 7:72969285-72969307 CACTTACAGGGGCCGGAGGCTGG - Exonic
1026790395 7:73327900-73327922 CACTTACAGGGGCCGGAGGCTGG - Exonic
1026818687 7:73531895-73531917 CAGCTACGGGAGGCTGAGGCAGG + Intergenic
1026843717 7:73685166-73685188 GGCCTACGGGAGGCTGAGGCAGG + Intronic
1026874471 7:73871482-73871504 CACCTGCAGCGGCCTGTGGCTGG + Intergenic
1026905945 7:74062887-74062909 CACCTTCGGGAGGCTAAGGCAGG + Intronic
1027104359 7:75395788-75395810 CACTTACAGGGGCCGGAGGCTGG + Exonic
1027248158 7:76380913-76380935 CAGCTACTTGAGGCTGAGGCAGG + Intergenic
1027674903 7:81145081-81145103 AAGCTACGGGAGACTGAGGCAGG + Intergenic
1028569291 7:92268587-92268609 CAGCTACGGGAGCCTGAGGTGGG - Intronic
1028624645 7:92864024-92864046 CTACTTCAGGAGGCTGAGGCAGG - Intergenic
1029108630 7:98198599-98198621 CTACTTCAGGAGGCTGAGGCAGG - Intronic
1029200070 7:98833530-98833552 CAGCTACCTGAGGCTGAGGCAGG - Intergenic
1029212174 7:98918006-98918028 CAGCTACTTGAGGCTGAGGCAGG + Intronic
1029292156 7:99510343-99510365 AACCTTCAGGAGACTGACGCAGG - Intronic
1029793291 7:102867812-102867834 CAGCTACAGGAGGCTGAGGCAGG - Intronic
1029864036 7:103606338-103606360 CACCTACAGAAGCCATAAGCAGG - Intronic
1029928800 7:104348269-104348291 CAGCTATTGGAGGCTGAGGCAGG + Intronic
1030135449 7:106243062-106243084 CACCTACAGAGGCCAGAGGAAGG + Intergenic
1030646015 7:112062789-112062811 CAGCTACTCGAGGCTGAGGCAGG - Intronic
1030683040 7:112452272-112452294 TAGCTACAGGAGGCTGAGGAGGG - Intronic
1031021919 7:116638240-116638262 GAATCACAGGAGCCTGAGGCAGG - Intergenic
1031134925 7:117873651-117873673 CACCTCCACGAGCCCGCGGCTGG - Intronic
1031198515 7:118647392-118647414 GACCCTCAGGAGGCTGAGGCAGG - Intergenic
1032149014 7:129411645-129411667 CAGCTACAGGAGTGTGAGGCAGG + Intronic
1032397233 7:131599356-131599378 CTACTTCAGGAGGCTGAGGCAGG + Intergenic
1032614333 7:133450273-133450295 CTACTCAAGGAGCCTGAGGCAGG - Intronic
1033093286 7:138406532-138406554 CTTCTTCAGGAGGCTGAGGCAGG - Intergenic
1033209268 7:139448579-139448601 CAGCTACTCGAGGCTGAGGCAGG + Intergenic
1033537661 7:142327256-142327278 CTACTTCAGGAGGCTGAGGCAGG - Intergenic
1034151831 7:148922781-148922803 CAGCTACTGGAGGCTAAGGCAGG + Intergenic
1034699030 7:153080794-153080816 CTCCTGCAGGAGGCTGAGGCTGG + Intergenic
1034832479 7:154321535-154321557 CACCTTTGGGAGGCTGAGGCGGG + Intronic
1034913458 7:155017317-155017339 CTACTCCAGGAGGCTGAGGCAGG + Intergenic
1034963047 7:155374253-155374275 CACCTTGGGGAGCCGGAGGCTGG - Intergenic
1035051089 7:155999396-155999418 CAGCTATAGGATCCTGAGCCAGG + Intergenic
1035459482 7:159030229-159030251 CAGCTATGGGAGGCTGAGGCAGG + Exonic
1035568063 8:654865-654887 CCCCAGCAGGAACCTGAGGCGGG + Intronic
1035729318 8:1843417-1843439 TACCTGCAGGAGCGGGAGGCAGG - Exonic
1035767446 8:2118724-2118746 CCCCTGCAGGACCCAGAGGCTGG + Intronic
1036021036 8:4846530-4846552 ATCTTACAGGAGCCTGTGGCTGG - Intronic
1036147748 8:6270228-6270250 CAGCTACTGGAGGCTGAGGCAGG + Intergenic
1036548204 8:9792430-9792452 CAGCTGAAGGAGGCTGAGGCAGG + Intergenic
1036652165 8:10651611-10651633 CAGCTACAGGAGGCTGAGGCAGG + Intronic
1037027359 8:14055494-14055516 CAACTTCAGGATCCTGAGGTGGG - Intergenic
1038290991 8:26249763-26249785 CAGCTACAGGAGGCTGAGGCAGG + Intergenic
1038307474 8:26417612-26417634 CTGGTACAGGAGGCTGAGGCAGG + Intronic
1038424556 8:27456031-27456053 CACATACAGGAGCCCTAGGTGGG + Intronic
1038531595 8:28322140-28322162 CACCTTAGGGAGGCTGAGGCGGG + Intronic
1039323350 8:36457410-36457432 CAGCTACGGGAGGCTGAGGCAGG + Intergenic
1039659679 8:39448698-39448720 CACCTCTAGGTGCCTGAGTCAGG - Intergenic
1039782228 8:40796972-40796994 CACCTCCAGGGGCCACAGGCAGG + Intronic
1039813260 8:41068896-41068918 CACCTGTAGGAGTCTGAGGTGGG - Intergenic
1039947700 8:42144159-42144181 CACATATAGTAGCCAGAGGCAGG - Intergenic
1040427836 8:47307330-47307352 CAGCCTCAGGAGGCTGAGGCAGG - Intronic
1040743059 8:50604302-50604324 CAGCTACAGGGGGCTGAGGTGGG + Intronic
1041236253 8:55805768-55805790 CAGCTACAGGAGGCTGAGGCAGG + Intronic
1041686497 8:60649488-60649510 CAGCTACAGGAGGCTGATGCAGG + Intergenic
1042251903 8:66764580-66764602 CAGCTACAGGAGGCTGAGGTGGG - Intronic
1042598479 8:70474235-70474257 CAGCTACAGGAAGCTGAGGCAGG - Intergenic
1042778526 8:72464155-72464177 CAGCTACTGGAGGCTGAGGCAGG - Intergenic
1043475340 8:80600336-80600358 CAGCTACAGGGGACTGAGGTGGG - Intergenic
1043688595 8:83120700-83120722 CTGCTACGGGAGGCTGAGGCAGG + Intergenic
1043858661 8:85290171-85290193 TCCCAACAGGAGGCTGAGGCAGG - Intergenic
1044963832 8:97556666-97556688 CAGCTACATGAGGCTGAGGCAGG + Intergenic
1045400316 8:101809656-101809678 CAGCTACAGGAGGCTGAGGCAGG - Intronic
1045512642 8:102824811-102824833 CAGCTACTCGAGGCTGAGGCAGG - Intergenic
1045828518 8:106429547-106429569 CTACTTGAGGAGCCTGAGGCAGG + Intronic
1045869327 8:106907398-106907420 CAGCTGCTGGAGGCTGAGGCAGG - Intergenic
1046932983 8:119859463-119859485 CACTTAGGGGAGGCTGAGGCAGG - Intergenic
1047003049 8:120592291-120592313 CAGCTAAAGGAGGCTGAGGCAGG - Intronic
1047341048 8:123980873-123980895 CACCTTCAGGAACCTGTGGCAGG - Intronic
1047484644 8:125318160-125318182 GCACTTCAGGAGCCTGAGGCAGG + Intronic
1048057644 8:130883670-130883692 CATCTGCAGGAGCCTTGGGCAGG - Intronic
1048173813 8:132133598-132133620 GCCCTTCAGGAGGCTGAGGCGGG - Intronic
1048306796 8:133290099-133290121 AACAGACAGGAGTCTGAGGCTGG - Intronic
1049293319 8:141815756-141815778 TAACTACAGGGGCCAGAGGCTGG + Intergenic
1049688119 8:143947131-143947153 CACCTAGAGCACCCTGTGGCTGG + Intronic
1049705079 8:144038013-144038035 CAGCTACGCGAGGCTGAGGCAGG + Intronic
1049981131 9:904828-904850 CAGCTACTCGAGGCTGAGGCAGG + Intronic
1050187350 9:2988351-2988373 AGCCTCCAGGAGACTGAGGCAGG + Intergenic
1050364939 9:4865086-4865108 CACCTAAAACAGCCTGAGGTTGG - Intronic
1050539276 9:6656275-6656297 CACTTAAAGGAGGCCGAGGCTGG - Intergenic
1050879112 9:10676809-10676831 CACCTGCAGGAAGCTGAGGAGGG - Intergenic
1051577498 9:18633475-18633497 CAGCTACTTGAGGCTGAGGCAGG + Intronic
1051670662 9:19506600-19506622 CAGCTACTGGAGGCTGAGGCAGG - Intergenic
1051776523 9:20640140-20640162 CTACTTCAGGAGGCTGAGGCGGG - Intergenic
1051801593 9:20940396-20940418 CAGCTACTTGAGGCTGAGGCAGG - Intronic
1052267788 9:26594322-26594344 CTACTTCAGGAGGCTGAGGCAGG - Intergenic
1052456411 9:28705026-28705048 CAGATACAGGAGGCTGAGGTGGG - Intergenic
1052630280 9:31028828-31028850 GCACTACAGGAGGCTGAGGCGGG + Intergenic
1052640602 9:31161534-31161556 ATCCTTCAGGAGACTGAGGCGGG + Intergenic
1052976087 9:34411299-34411321 TAGCTACATGAGGCTGAGGCAGG + Intronic
1053520888 9:38778188-38778210 CCGCTACAGGAGGCTGAGGCAGG + Intergenic
1054193044 9:62002181-62002203 CAGCTACAGGAGGCTGAGGCAGG + Intergenic
1054645365 9:67586510-67586532 CAGCTACAGGAGGCTGAGGCAGG - Intergenic
1055038654 9:71845473-71845495 CAGCTACAGGAGGCTGAGCTGGG - Intergenic
1055396266 9:75878069-75878091 CACCTTTGGGAGTCTGAGGCAGG + Intergenic
1055407939 9:75994534-75994556 CAGCTTCGGGAGGCTGAGGCAGG - Intronic
1055483369 9:76732198-76732220 CAGCTACTGGGGGCTGAGGCAGG + Intronic
1055560902 9:77520675-77520697 CAAGCACAGGAGTCTGAGGCAGG - Intronic
1055660503 9:78498811-78498833 CAGCTACTGGAGGCTGAGGCAGG + Intergenic
1055733630 9:79304881-79304903 GAGCTTCAGGAGGCTGAGGCAGG - Intergenic
1056162601 9:83911653-83911675 CAGCTACTGGAGGCTGAGGCGGG - Intronic
1056357747 9:85819875-85819897 CAGCTGCTGGAGGCTGAGGCGGG + Intergenic
1056941542 9:90960714-90960736 CTACTACAGGTGCCTGATGCAGG - Intergenic
1057208496 9:93186895-93186917 AACCTACAGGACCATGAGGGAGG - Intronic
1057389925 9:94634180-94634202 CAGCTATGGGAGGCTGAGGCAGG + Intronic
1057435959 9:95040692-95040714 CACCTCCAGGAGCTTGGGCCAGG - Intronic
1057595874 9:96416013-96416035 TCCCTTCAGGAGGCTGAGGCTGG - Intronic
1057616628 9:96596745-96596767 CAGCTACAGGAGGCTGAGGTGGG + Intronic
1057620045 9:96626735-96626757 CTACTTCAGGAGGCTGAGGCAGG - Intergenic
1058682610 9:107453232-107453254 CACTTTCGGGAGGCTGAGGCAGG - Intergenic
1058732148 9:107860643-107860665 CAGCTACAGGAGGCTGAGGCAGG + Intergenic
1059244241 9:112836016-112836038 AACCTACAGGAGCCTGAGTCTGG + Intronic
1059369006 9:113810005-113810027 CTACTAAAGGAGGCTGAGGCAGG - Intergenic
1059486860 9:114633773-114633795 CACCAACACGGACCTGAGGCTGG + Exonic
1060100406 9:120835615-120835637 CTACTTCAGGAGGCTGAGGCAGG + Intronic
1060165738 9:121413047-121413069 CTACTTCAGGAGGCTGAGGCAGG - Intergenic
1060253787 9:122007361-122007383 CGCCTGTAGGAGGCTGAGGCAGG + Intronic
1060758360 9:126228455-126228477 CACCTGCTGGAGCCCGAGGCTGG + Intergenic
1060799714 9:126535855-126535877 GCCATTCAGGAGCCTGAGGCAGG + Intergenic
1060907569 9:127321243-127321265 CAGCTACTAGAGGCTGAGGCAGG - Intronic
1060907591 9:127321361-127321383 CACCTTTGGGAGCCTGAGGCAGG - Intronic
1060923176 9:127436946-127436968 CTACTTCAGGAGGCTGAGGCAGG + Intronic
1061362345 9:130151654-130151676 CCACTTCAGGAGGCTGAGGCAGG - Intergenic
1061483405 9:130908460-130908482 CAGCTTGGGGAGCCTGAGGCAGG + Intronic
1061539006 9:131267271-131267293 CAACTATGGGAGTCTGAGGCTGG + Intronic
1061587814 9:131579840-131579862 CACAAACAGGGCCCTGAGGCTGG + Intronic
1061782111 9:133002478-133002500 TGTCTACAGGAGGCTGAGGCAGG - Intergenic
1061855764 9:133441244-133441266 CCCCTACAGCAGCCAGAGACAGG + Intronic
1062320370 9:135987935-135987957 AGCCCACAGGATCCTGAGGCAGG + Intergenic
1203610308 Un_KI270748v1:90245-90267 CACCTGTAGGAGGCTGAGGTGGG + Intergenic
1185832621 X:3316555-3316577 CTACTTCAGGAGGCTGAGGCTGG + Intronic
1186872021 X:13782642-13782664 CTTGTACAGGAGGCTGAGGCAGG + Intronic
1187462975 X:19504006-19504028 CACAAACAGGAGGCTGAGGTAGG + Intronic
1187865531 X:23719946-23719968 CAGCTATGGGAGGCTGAGGCAGG - Intronic
1187894215 X:23965681-23965703 GATCTACAGGAGGCTGAAGCAGG + Intergenic
1188049450 X:25466812-25466834 CAGCTATGGGAGGCTGAGGCAGG - Intergenic
1188077307 X:25794036-25794058 CAGCTACGGGAGGCTGAGGCAGG + Intergenic
1190049678 X:47140453-47140475 CACTTACATGTGGCTGAGGCGGG - Intergenic
1190143311 X:47867083-47867105 CACATACTGGAGCCTGTGGGGGG + Intronic
1190292235 X:49000739-49000761 GCCCTATAGGACCCTGAGGCTGG + Intronic
1190405121 X:50079067-50079089 AACCTAGAGGAGGCCGAGGCGGG - Intronic
1190860237 X:54337952-54337974 AAACTCCAGGAGGCTGAGGCAGG + Intronic
1191092894 X:56642408-56642430 CACCTGCAGAAGATTGAGGCTGG - Intergenic
1192371926 X:70521388-70521410 CAGCTATGGGAGGCTGAGGCAGG - Intergenic
1192538157 X:71946184-71946206 CACAGACAGGAGCAGGAGGCAGG + Intergenic
1192779359 X:74278464-74278486 CAGCTATGGGAGGCTGAGGCAGG - Intergenic
1193589935 X:83376717-83376739 CACCTACAGGAGAATGAAACTGG - Intergenic
1194111571 X:89840428-89840450 CGCCTGTAGGAGGCTGAGGCTGG - Intergenic
1194730019 X:97441700-97441722 CAGCTACTGGAGGCTGAGGCAGG + Intronic
1195228990 X:102827076-102827098 CACCTACAGGACCCTGCACCAGG + Intergenic
1195524008 X:105865011-105865033 CCCCAACAGGAGCCTGAAGGGGG - Intronic
1195593441 X:106659225-106659247 GCACTTCAGGAGCCTGAGGCAGG - Intronic
1196013045 X:110908563-110908585 CAGCTTCAGGAGGCTGAGACAGG - Intergenic
1196754058 X:119142661-119142683 CAGCTACAGGAGGCTGAGGCAGG + Intronic
1196799613 X:119531001-119531023 CAACTTCGGGAGGCTGAGGCAGG - Intergenic
1196858029 X:120001484-120001506 CTACTCCAGGAGGCTGAGGCGGG + Intergenic
1197706026 X:129635070-129635092 CTCTTCCAGGAGACTGAGGCTGG + Intergenic
1198459993 X:136853890-136853912 CAGCTACGGGAGGCTGAGGTAGG + Intronic
1199301374 X:146218196-146218218 CCTCAACAGGAGGCTGAGGCAGG - Intergenic
1199371553 X:147055847-147055869 CAGCTACAGGAGGCTGAGGTGGG + Intergenic
1199644510 X:149893284-149893306 CAGATTCAGGAGGCTGAGGCAGG + Intergenic
1200010550 X:153117335-153117357 CAAATACAGGAGGCTGAGGCAGG - Intergenic
1200029050 X:153282587-153282609 CAAATACAGGAGGCTGAGGCAGG + Intergenic
1200060187 X:153480609-153480631 CACCCAGACAAGCCTGAGGCTGG + Intronic
1200098533 X:153675637-153675659 CAGCTACTCGAGGCTGAGGCGGG - Intronic
1200159357 X:153997659-153997681 CAGCTACCTGAGGCTGAGGCAGG + Intergenic
1200415079 Y:2901079-2901101 CAGCTACTAGAGGCTGAGGCAGG + Intronic
1200464236 Y:3495234-3495256 CGCCTGTAGGAGGCTGAGGCTGG - Intergenic
1200736682 Y:6806533-6806555 TACCCACAGGAGGCTGAGGCAGG - Intergenic
1201072207 Y:10157780-10157802 TCCATTCAGGAGCCTGAGGCGGG + Intergenic
1201397614 Y:13565512-13565534 GACATTCAGGAGGCTGAGGCAGG + Intergenic
1202110343 Y:21410719-21410741 CTGTTACAGGAGGCTGAGGCAGG - Intergenic
1202580842 Y:26378944-26378966 CACTTACGGGAGGCCGAGGCAGG + Intergenic