ID: 1071286523

View in Genome Browser
Species Human (GRCh38)
Location 10:84152986-84153008
Sequence AAACATGACCACATCTATAT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 164}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071286523_1071286524 18 Left 1071286523 10:84152986-84153008 CCAATATAGATGTGGTCATGTTT 0: 1
1: 0
2: 1
3: 18
4: 164
Right 1071286524 10:84153027-84153049 ATCATACAGAGAATCCTTGATGG 0: 1
1: 0
2: 2
3: 9
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071286523 Original CRISPR AAACATGACCACATCTATAT TGG (reversed) Exonic
900206280 1:1433229-1433251 AAACATGACCACAGCCAGCTGGG + Intergenic
906647373 1:47485138-47485160 ACACATGCACACATGTATATTGG - Intergenic
907148577 1:52260484-52260506 AGACATGATCAGATCTGTATGGG - Intronic
907559691 1:55377181-55377203 AAAAATGACCACAGAAATATTGG + Intergenic
911870078 1:103086278-103086300 AGACATGAACACATCTATGAAGG + Intronic
914582031 1:149028278-149028300 ATAAATGACCACATTTGTATTGG - Intronic
916343022 1:163757712-163757734 AAATATGACCTCATCTTAATTGG - Intergenic
916368021 1:164055868-164055890 AAACATGACCACCTCTCTTGAGG + Intergenic
917769864 1:178266089-178266111 AAACATGTCCACATTTCTGTTGG + Intronic
918120415 1:181533442-181533464 AAAACAGACCACATATATATGGG - Intronic
919684879 1:200474432-200474454 AAACTTGACAATATCTATATGGG - Intergenic
922038826 1:221875852-221875874 GAACATTACTACATCCATATAGG + Intergenic
923806964 1:237268083-237268105 AAACAAAACCACAGATATATGGG - Intronic
1063026602 10:2185013-2185035 AAAGATGAACACATCCATATTGG + Intergenic
1064130402 10:12704402-12704424 CAACATGCCCACATTTATACTGG - Intronic
1066678941 10:37917524-37917546 AGACATGCCCACAGCTATCTTGG - Intergenic
1071286523 10:84152986-84153008 AAACATGACCACATCTATATTGG - Exonic
1071720413 10:88138353-88138375 AAATATGACCCCATCTAACTTGG - Intergenic
1072031979 10:91529963-91529985 AAAGGTGACCAGATCTTTATGGG - Intergenic
1076254703 10:129012755-129012777 GAACATGACCCCAGCTACATCGG + Intergenic
1076309476 10:129494239-129494261 AAAAATGACCATATCACTATTGG - Intronic
1077716194 11:4582917-4582939 ACACATGAACACACCTATGTAGG - Intergenic
1077716896 11:4590134-4590156 ACACATGAACACACCTACATAGG - Intergenic
1077754982 11:5017938-5017960 AAACCTGAACTCATCTATTTTGG + Intergenic
1079192316 11:18290149-18290171 AAACATGACCACATCCCTTAAGG + Intronic
1079544423 11:21615263-21615285 AAAAATTACCACGTCTATCTGGG + Intergenic
1083754403 11:64782773-64782795 AAACATGCACACATCTGTATGGG - Intergenic
1084907993 11:72363481-72363503 AAACATGTTCACATCTTTAAAGG - Intronic
1086772939 11:90791775-90791797 ACACATGACCTCTTTTATATTGG - Intergenic
1088152937 11:106768920-106768942 GAACATGACCACAGGTATAAGGG + Intronic
1089564843 11:119365252-119365274 ACACATGACCACAGCTACATGGG + Intronic
1091249076 11:134126604-134126626 AAACATGAGCACACAGATATGGG + Intronic
1092115282 12:5996989-5997011 AACCACGACCACATCTACAATGG + Intronic
1093713313 12:22352789-22352811 ATATATGCCCACATATATATGGG + Intronic
1093771344 12:23021931-23021953 AAAGATGTGCACAGCTATATGGG - Intergenic
1095248317 12:39947510-39947532 AAACATGAACACATGTATTTAGG + Intronic
1097730286 12:63121443-63121465 ACACATGACCACCTCTAGAGAGG - Intergenic
1100023675 12:90101589-90101611 AATCAAGATCACATCTTTATGGG + Intergenic
1101925482 12:108967945-108967967 AAACATGAAGATGTCTATATGGG + Intronic
1102759608 12:115374261-115374283 AAACATGACCACAAGTAGAAAGG + Intergenic
1104114595 12:125737153-125737175 AAACATGATCACAGTCATATTGG - Intergenic
1105329316 13:19400465-19400487 AAAAATGACCACATTTAGATAGG + Intergenic
1105620844 13:22064547-22064569 AAAAATGAATACATCTATATGGG + Intergenic
1105862535 13:24428803-24428825 AAAAATGACCACATTTAGATAGG - Intronic
1108274508 13:48793909-48793931 AAAAATGACCACATCAAGTTTGG - Intergenic
1109458972 13:62628901-62628923 AAACATGCATACATCTATAGAGG - Intergenic
1110139732 13:72113812-72113834 TAACATCAACACAGCTATATGGG - Intergenic
1111642292 13:90983694-90983716 AAACATGAATACCTCAATATTGG - Intergenic
1114471604 14:22966981-22967003 AAACATGAGCAAATCTTTACTGG - Intronic
1115802419 14:37010110-37010132 AAACATAACCACATATATAATGG + Intronic
1116160325 14:41259610-41259632 TAACATTATCACATATATATAGG - Intergenic
1116195000 14:41714284-41714306 AAGCATGACCAAATTTATGTGGG - Intronic
1116515650 14:45801946-45801968 CAAAATAACCACATCAATATAGG - Intergenic
1116610309 14:47061512-47061534 AAAGATGACAACATCCAGATTGG - Exonic
1117492581 14:56265321-56265343 AACCATGTCCATATATATATGGG - Intronic
1120358697 14:83466669-83466691 AAACATGACCAAATCTAAGTGGG + Intergenic
1122039664 14:98975783-98975805 AAACCTAACCATATCTATAATGG + Intergenic
1124090213 15:26592330-26592352 CAAGATCACCACATCCATATTGG + Intronic
1124162027 15:27279953-27279975 AAAAATGTCAAAATCTATATAGG - Intronic
1124578659 15:30931727-30931749 AAACAGACCCACATATATATGGG - Intronic
1126157485 15:45578828-45578850 AAATATGAACACATTCATATAGG - Intergenic
1131035936 15:89221976-89221998 AAATATGACTACATCTACAGTGG + Intergenic
1138098159 16:54229952-54229974 AAACAAGACCAAATTTAAATAGG + Intergenic
1144935502 17:18895065-18895087 AAAAAAGTACACATCTATATGGG - Intronic
1145120942 17:20259177-20259199 ACACATGACTTCATCTATTTGGG - Intronic
1146424786 17:32726799-32726821 ATACATGACCAAATATATTTTGG + Intronic
1146930343 17:36772562-36772584 ACACATGACCACATTTCTGTTGG + Intergenic
1147609042 17:41790880-41790902 AGACATAACCACTTCTATAAAGG + Intergenic
1149263041 17:54900171-54900193 AGACATGACCACAACTTTAAAGG + Intronic
1151739620 17:75971355-75971377 AAACTTGCCCACAGCCATATAGG + Intronic
1156412826 18:36851053-36851075 AAACATGACCATATCAATTGAGG - Intronic
1157013895 18:43685978-43686000 AAAGATGAGCACATATTTATAGG + Intergenic
1157043742 18:44070091-44070113 AAACATACCCACATACATATAGG - Intergenic
1157905484 18:51565741-51565763 AAATATGTGCACATCTATAGTGG - Intergenic
1158996647 18:62927304-62927326 AAAGATGAACAGATCCATATTGG + Intronic
1159324533 18:66897273-66897295 TAACATAACCACATTTATTTAGG + Intergenic
1160363966 18:78308540-78308562 AAATAAGACCACATCCATACGGG - Intergenic
1163983316 19:20922143-20922165 ATACATGTCCACATGTATTTCGG - Intergenic
1165038066 19:33049030-33049052 AAACCTGACCACATATCTATGGG - Intronic
1167779087 19:51584590-51584612 ATAAATGACCACCTGTATATGGG + Intronic
925906604 2:8543554-8543576 AAACATGAAACCATTTATATTGG + Intergenic
926345772 2:11943655-11943677 AAACATGAAAAAATATATATAGG - Intergenic
926838629 2:17052808-17052830 CAACATGCCCACAGCTACATGGG - Intergenic
926861367 2:17313151-17313173 ATACATGATCACCTCTACATTGG + Intergenic
927826673 2:26314220-26314242 TAACATAACCACATGTGTATAGG - Intronic
929170944 2:38932866-38932888 AACTATGACCACGTCTATACAGG - Intronic
929338908 2:40788355-40788377 AATTGTAACCACATCTATATTGG + Intergenic
930325893 2:49917018-49917040 AAAGATGACCACATATTTAGGGG + Intergenic
933493849 2:83022678-83022700 AAAAATGACCACATGGAAATTGG + Intergenic
934158666 2:89227527-89227549 AACCATGTCAACATCTATCTTGG - Intergenic
934208608 2:89954900-89954922 AACCATGTCAACATCTATCTTGG + Intergenic
935096015 2:99945085-99945107 AGACATGAGCACATGTATAGAGG + Intronic
936816996 2:116472103-116472125 AAAAATGACCAAGTCTATTTGGG - Intergenic
939576944 2:143907330-143907352 AGAAATGAGCACATCTAAATGGG - Intergenic
939705386 2:145446574-145446596 AAACTTGGCCACAGGTATATAGG - Intergenic
941772333 2:169358669-169358691 AAACATTACCACATTTTTATTGG + Intronic
942904212 2:181161522-181161544 ACCCATAATCACATCTATATAGG + Intergenic
943950096 2:194123045-194123067 AAACAAGACCCCAAGTATATAGG + Intergenic
945630101 2:212263976-212263998 CAACATGACCACAGCAATATAGG - Intronic
946686309 2:222274499-222274521 AAACGTAACCACCTCTATAAAGG + Intronic
946914603 2:224504826-224504848 AAACATGCTCACATCTGAATTGG - Intronic
947348945 2:229222354-229222376 AAACATGTCCACATGTAGATTGG - Intronic
947400416 2:229726340-229726362 AAGCCAGACAACATCTATATAGG + Intergenic
1179169525 21:38962247-38962269 AATAATGACCATATCTATGTGGG + Intergenic
1183212415 22:36459044-36459066 AAAAATGACCATATCCTTATAGG + Intergenic
949111276 3:263761-263783 AACATTCACCACATCTATATTGG + Intronic
949313971 3:2731048-2731070 AAAAATGACCACATCTGTAATGG - Intronic
955124623 3:56098948-56098970 GAACATGGACACATCTATTTGGG - Intronic
955309484 3:57870823-57870845 CAAAATGACCAAATCTATTTTGG - Intronic
956541286 3:70342772-70342794 AAACATAATCACATTTACATTGG - Intergenic
958584752 3:96071660-96071682 AAACTTGAGCACATCTCTTTGGG + Intergenic
959121411 3:102237018-102237040 AAAAATGACCACGTCTGTCTTGG + Intronic
960080377 3:113534150-113534172 ATACATAAACACATTTATATGGG - Intronic
960505217 3:118485703-118485725 CAAAATGACCACATTTATTTTGG + Intergenic
965774417 3:172213628-172213650 AAACAAGACTACATCAAAATGGG - Intronic
967101274 3:186217835-186217857 AAACATGAAAACATTTATTTGGG + Intronic
967831982 3:193927390-193927412 AAACAGTACCATATATATATAGG - Intergenic
969506413 4:7590898-7590920 ACACATCACCATATCTATATAGG + Intronic
970358921 4:15287007-15287029 TAACATAACCACATTTATTTAGG - Intergenic
971167110 4:24195265-24195287 AATCTTCACCACAGCTATATGGG - Intergenic
973314327 4:48743959-48743981 ACACATGTACACATGTATATGGG - Intronic
974365937 4:60948735-60948757 AAACATTAACAAATCTATCTTGG - Intergenic
974452011 4:62076401-62076423 ATACATGAACAAATCTCTATTGG + Intronic
975091291 4:70407331-70407353 AAACATAAACACATTTATTTGGG - Intronic
975202493 4:71607862-71607884 GAACCTGAGCACATCTATAGAGG - Intergenic
975931573 4:79530399-79530421 AAACATGACCACCTCTCTTCCGG + Intergenic
977451809 4:97208323-97208345 AAACATTAAAATATCTATATAGG - Intronic
978131131 4:105199213-105199235 AAACATGATTACATCCTTATAGG + Intronic
979544627 4:121925934-121925956 AAACAAGACCATTTCTACATTGG + Intronic
980789335 4:137599329-137599351 AATTATGACCACAACAATATTGG - Intergenic
981569195 4:146133612-146133634 AAACATGATCACATTTACTTTGG + Intergenic
981613193 4:146618492-146618514 TGACATCACCACATCTATCTGGG - Intergenic
983915111 4:173283359-173283381 AGGCATGACCACGTCTAGATCGG - Intronic
983977479 4:173953053-173953075 AAACATGACCACCTCAAATTTGG + Intergenic
984655680 4:182315712-182315734 AATTTTGACCACATGTATATTGG + Intronic
992649122 5:78840133-78840155 AAACATCACCAGATGTATGTAGG + Intronic
993134438 5:83939744-83939766 AATCATGACAACATCTATACAGG - Intergenic
994020533 5:95018965-95018987 AAACATAAACACATACATATAGG + Intronic
994829527 5:104761280-104761302 AAAAAACACCATATCTATATAGG + Intergenic
994873923 5:105391227-105391249 AAAAATGTCTACATCTATAGAGG - Intergenic
995145130 5:108779549-108779571 AAACACAACAACATTTATATTGG - Intronic
995438699 5:112165947-112165969 AAGCATGAACCCATCTATTTGGG + Intronic
996776535 5:127138393-127138415 AAACATGACCACACTCATCTAGG + Intergenic
999174661 5:149623572-149623594 AAACGTGACCACCTCTCTACTGG - Intronic
1000733968 5:164874783-164874805 AAACAAAACCACATTTATTTAGG - Intergenic
1005183123 6:23129829-23129851 AAACATGTCTACACATATATGGG + Intergenic
1005288460 6:24354555-24354577 AAATATGACTACTTTTATATAGG - Intronic
1006218154 6:32463810-32463832 AAACATGACCCCTTCTACTTGGG + Intergenic
1008056323 6:46949665-46949687 AAATATGACTACATGGATATGGG - Intronic
1009830392 6:68923204-68923226 AAACATGACCAGAACTACTTTGG + Intronic
1011481116 6:87795102-87795124 AAGCATGACCACACCCATAAGGG - Intergenic
1016493146 6:144629677-144629699 TTACATGACAACATCTACATTGG - Intronic
1016898413 6:149076595-149076617 AAACATGACAACATTTTTTTTGG + Exonic
1020841496 7:13223366-13223388 CAACATGATAACAGCTATATTGG - Intergenic
1020991663 7:15204712-15204734 AAACATGACAGCATCTGTACAGG - Intronic
1021538782 7:21733878-21733900 AAATATATCCACAGCTATATGGG + Intronic
1024946255 7:54810130-54810152 AAACATTTCCACATCTATCTGGG - Intergenic
1025601786 7:63007631-63007653 AAACATGACCACATTCTTACTGG + Intergenic
1026352779 7:69532081-69532103 AAACATGTCCACATCTATAGGGG + Intergenic
1027186183 7:75972104-75972126 AAACAAGCCCATATCTATCTGGG + Intronic
1027850579 7:83446273-83446295 AAGATTGACCACATGTATATAGG + Intronic
1030198756 7:106880357-106880379 AAACATGACCAGTTTTAAATAGG - Intronic
1030424456 7:109356372-109356394 AAACATGACCAAACCAATTTAGG - Intergenic
1031398994 7:121309158-121309180 TAATATGTCCACATCTGTATTGG + Intergenic
1031954919 7:127933085-127933107 AAACATGGCCACAAATGTATAGG + Intronic
1038362933 8:26901178-26901200 AAACATAACTACCTCTGTATAGG + Intergenic
1039188848 8:34949173-34949195 AAACATAACTACATTTTTATGGG + Intergenic
1040599002 8:48865992-48866014 AAACAGGACCTCAATTATATAGG + Intergenic
1040710215 8:50178834-50178856 AAGCATGACTACATCAAAATAGG - Intronic
1043770165 8:84187852-84187874 AAACATGACCACACTTTTACTGG - Intronic
1043844256 8:85146439-85146461 AAACATAACAACATGTATAATGG + Intergenic
1044902320 8:96960016-96960038 AAACCTGACCACATTCATGTTGG - Intronic
1046560605 8:115832545-115832567 AAACATGAGGAAATCTGTATAGG - Intergenic
1048286445 8:133145521-133145543 AAATATGACCACATATTTAGTGG - Intergenic
1050717853 9:8550221-8550243 GAACATGACAATATTTATATTGG - Intronic
1055022155 9:71681917-71681939 AAACATGACCTCATCTCTTAAGG + Intergenic
1055861816 9:80760069-80760091 AAACATGACTCAATCTAGATGGG + Intergenic
1060092636 9:120757161-120757183 ACACATGACAACATTTTTATGGG - Exonic
1188891798 X:35620538-35620560 TCACTTGACCACATCTGTATAGG - Intergenic
1188939414 X:36218467-36218489 AAAAATGACCACAACTGTAGGGG + Intergenic
1193908270 X:87269411-87269433 TAATATGAACATATCTATATAGG - Intergenic
1196083876 X:111662747-111662769 AAACATGACAAAATTTTTATAGG + Intergenic
1199463063 X:148105062-148105084 TATCATCACTACATCTATATAGG - Intergenic
1202602574 Y:26609139-26609161 AAAAATGACCATATTTAGATAGG - Intergenic