ID: 1071287403

View in Genome Browser
Species Human (GRCh38)
Location 10:84161796-84161818
Sequence CTTTAGGCTGAAACTTGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071287395_1071287403 4 Left 1071287395 10:84161769-84161791 CCAAATACAAGGGTCCTGAGTCC No data
Right 1071287403 10:84161796-84161818 CTTTAGGCTGAAACTTGGGCTGG No data
1071287397_1071287403 -10 Left 1071287397 10:84161783-84161805 CCTGAGTCCCCTACTTTAGGCTG No data
Right 1071287403 10:84161796-84161818 CTTTAGGCTGAAACTTGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071287403 Original CRISPR CTTTAGGCTGAAACTTGGGC TGG Intergenic
No off target data available for this crispr