ID: 1071288325

View in Genome Browser
Species Human (GRCh38)
Location 10:84169441-84169463
Sequence CTCTGGTTGATGAAGTGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 419
Summary {0: 2, 1: 84, 2: 92, 3: 53, 4: 188}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071288325 Original CRISPR CTCTGGTTGATGAAGTGCCA GGG Intergenic
900202396 1:1415638-1415660 CTCTGGTTGATGAAATGCCAGGG + Intergenic
901946096 1:12705201-12705223 CTCTGGCTGGTGAAATGCCAGGG + Intergenic
902052112 1:13571933-13571955 CTCTGGTTGATGAAATGCCAGGG - Intergenic
904571110 1:31465892-31465914 TTCTGGTTGATGAAATGTCAGGG - Intergenic
904712828 1:32443852-32443874 CTCTGGTTGATGAAATGTCAGGG + Intergenic
904807551 1:33142490-33142512 TTCTAGTTGATTAATTGCCAGGG - Intergenic
905061058 1:35139509-35139531 TTCTGGTTGATGTAATGCCAGGG + Intergenic
906066030 1:42980718-42980740 CTCTGGTTGATGAGGTTCCTGGG - Intergenic
906430816 1:45754579-45754601 GTCTGGTTGATGAAATGCCAAGG + Intergenic
906499223 1:46328975-46328997 CTCTGGTTGATGAAATGCCAGGG + Intergenic
910852866 1:91665859-91665881 TTCCGGTTGATGAAATGCCAGGG + Intergenic
912816115 1:112829993-112830015 CTCTGGTTGATGAAATGCCAGGG - Intergenic
912980327 1:114365361-114365383 CTCTGGTTGATGAAATGCCAGGG + Intergenic
916766541 1:167866208-167866230 CTCTTGTTGATGAAATGCCAGGG - Intronic
917115920 1:171603374-171603396 CTCTGGTTGATGAAATGCCAGGG - Intergenic
918703925 1:187638017-187638039 CCCTGGTTGATGAAATGCCAGGG - Intergenic
918924413 1:190763474-190763496 CTCTTGTTGCTAAAGTGCAATGG + Intergenic
919610923 1:199744800-199744822 CTGTGGTTGATGAAGAGGCAGGG + Intergenic
920450262 1:206055450-206055472 CTCTGGTTGATGAAATGCCAGGG - Intronic
921074737 1:211691169-211691191 TTCTGGTTGATGAAATGCCAGGG - Intergenic
921927239 1:220721525-220721547 CTCTGGTTGATGAAATGCCAGGG - Intergenic
922680671 1:227592788-227592810 CTCTGGTTGATGAAATGCCAGGG + Intronic
922690244 1:227683315-227683337 CTCTGGTTGAGGAAATGCCAGGG - Intergenic
923633798 1:235674365-235674387 ATTTGGTTGATGAAATGCCAGGG - Intronic
924321645 1:242856608-242856630 TTCTGCTTGATGAAGTGACTTGG - Intergenic
924858982 1:247901732-247901754 TTCTGGTTGATGAAATGCCAGGG + Intergenic
1063159077 10:3406784-3406806 TTCCGGTTGTTGAAGTGCCACGG - Intergenic
1063569064 10:7197639-7197661 CTGTGGTTGATGAAGAGCTGAGG + Exonic
1064176954 10:13083262-13083284 TTCTGGTTGATGAAATGCCAGGG - Intronic
1064756579 10:18576867-18576889 CTCTGGTTGATGAAATGCCAGGG - Intronic
1065802321 10:29363880-29363902 CTCTGATTGATGAAATGCCAGGG + Intergenic
1065931099 10:30479783-30479805 CTCTGGTTGATGAAATGCCAGGG - Intergenic
1067306560 10:45070028-45070050 TTCTGGTTGATGAAATGCCAGGG - Intergenic
1068671708 10:59729878-59729900 TTCTGGTTGATGAAATGCCAGGG + Intronic
1068675708 10:59767355-59767377 CTCTGGTTGATGAAATGTCAGGG + Intergenic
1069939341 10:71943794-71943816 CTCCGGCTGATGAAATGCCAGGG - Intergenic
1070126638 10:73627186-73627208 CTCTGTTTGATGGAGTGCAGTGG - Intergenic
1070704120 10:78625137-78625159 GTCTCTTTGATGAAATGCCAAGG - Intergenic
1070992758 10:80746746-80746768 TTCTGGTTGATTAAATGCCAGGG - Intergenic
1071288325 10:84169441-84169463 CTCTGGTTGATGAAGTGCCAGGG + Intergenic
1072334890 10:94389186-94389208 CTCTGGTTGATGAAATGCCAGGG - Intergenic
1072625864 10:97111455-97111477 CTCTGATAGGTGAAGTGACAAGG + Intronic
1072689088 10:97558890-97558912 CTCTGGTTGATGAAATGCCAGGG + Intronic
1083082123 11:60104781-60104803 TTCTGGTTGATGAAATGCCAGGG + Intergenic
1083089978 11:60189767-60189789 CTCTGGCTGATGAAATGCCAGGG - Intergenic
1083376056 11:62222306-62222328 CTCTGGCTGATGAAATGTTAGGG - Intergenic
1084222224 11:67689512-67689534 TTCTGGTTGATGAATTGCCAGGG - Intergenic
1085239874 11:75044396-75044418 CTCTGGTTGATGAAATGCCAGGG - Intergenic
1085720431 11:78907579-78907601 TTCTGGAGGATGAAGAGCCATGG + Intronic
1085998835 11:81954542-81954564 TTCTGGTTGATGAAATGCCAGGG - Intergenic
1086275285 11:85120259-85120281 CTTTTGTAGATCAAGTGCCATGG + Intronic
1086973370 11:93106921-93106943 CTCTGGTTGATGAAATGCCAGGG + Intergenic
1087456685 11:98395630-98395652 CTCTGGTTGATGAAATGCCAGGG + Intergenic
1087639940 11:100746028-100746050 CTCTGGTTGATTAAATGCCAGGG + Intronic
1087684601 11:101248874-101248896 CTCTGGTCGATGAAATGCCAGGG - Intergenic
1087755530 11:102050753-102050775 ATCAGGTAGATGAAGTGGCAAGG + Intronic
1087894904 11:103576377-103576399 CTCTGGTTGATGAAATGCCAGGG - Intergenic
1088108239 11:106229307-106229329 CTCTGGTTGATGAAATGTCAAGG - Intergenic
1088758773 11:112909731-112909753 CTCTAGTTGATAAGGAGCCAAGG - Intergenic
1089698900 11:120232342-120232364 CTCTGGTGGATGAGGGGACAAGG + Intergenic
1090332064 11:125940051-125940073 CTCTGGAAGATGCAGTGACAAGG + Intergenic
1090445957 11:126764926-126764948 CTCTGGTTTTTCAAGTGCAAGGG + Intronic
1091814423 12:3425763-3425785 CTCTGGTTGATGAAATGCCAGGG + Intronic
1092586201 12:9903926-9903948 TTTTGGTTAATGAAATGCCAGGG + Intronic
1093356883 12:18177285-18177307 CTCTGGTTGATGAAATGCCAGGG - Intronic
1093594028 12:20940455-20940477 CTCTGGTTGATGAAATGCCAGGG + Intergenic
1094614888 12:32027293-32027315 TTCTGATTGATGAAATGCCAGGG - Intergenic
1094678022 12:32640313-32640335 ATGTGGTGGATGAAATGCCAAGG + Exonic
1095162226 12:38932233-38932255 TCCTGGTTGATGAAATGCCAGGG + Intergenic
1096207806 12:49738090-49738112 CTCTGGTTGATGAAATGCCAGGG - Intronic
1096266519 12:50127267-50127289 CTCTTGATGAAGAAGTGGCAAGG - Intergenic
1096445383 12:51686009-51686031 CTTTGGTTGAGAAAGTGCAAAGG + Intronic
1098248478 12:68544551-68544573 CTCTGGTTGATGAAATGCCAGGG - Intergenic
1098359970 12:69645098-69645120 TTCTGGTTGATGAAATGCCAGGG + Intronic
1098639448 12:72821702-72821724 CTCTTGTTGATGAAATGCCAGGG + Intergenic
1102151514 12:110691583-110691605 CTCTGGTTGAGGAAGGGAAAAGG + Intronic
1102606528 12:114071865-114071887 CTCTGGTTGATGAAATGCCAGGG - Intergenic
1104011985 12:124937685-124937707 TTCTGGTTGATGAAATGCCAGGG - Intergenic
1104203403 12:126614173-126614195 TTCTGGTTGATGAAATGCCAGGG + Intergenic
1104215488 12:126728944-126728966 TTCTGGGTGATCAAGTGCCCAGG - Intergenic
1105223707 13:18408378-18408400 CTCAGGTTGAGGAGGGGCCAGGG + Intergenic
1105569562 13:21588734-21588756 CTCTGGTTGATGAGATGCTAGGG - Intronic
1105695691 13:22886414-22886436 CTCTGGTTGATGAAATGCCAGGG - Intergenic
1106407858 13:29489230-29489252 CTCTTGTTGCTGGAGTGCAATGG - Intronic
1107187923 13:37546345-37546367 CTCTGCTTGGTGAAGAGTCAGGG + Intergenic
1109192692 13:59344651-59344673 ATCTGTTTTATGTAGTGCCAAGG + Intergenic
1109909363 13:68890006-68890028 CTCTGGTTGATGAAATGCCAGGG + Intergenic
1113636604 13:111923287-111923309 GTCTGGCTGAGGAAGGGCCAGGG + Intergenic
1114007863 14:18333267-18333289 CTCAGGTTGAAGAGGGGCCAGGG + Intergenic
1114146243 14:19980981-19981003 TTCTAGTTGATGAAATGCCAGGG - Intergenic
1114206887 14:20580344-20580366 CTCTGGTTGCTGGAGTGAAAAGG + Intergenic
1114223382 14:20716839-20716861 CTCTGGTTGATGAAATGCTAGGG + Intergenic
1114235944 14:20823952-20823974 CTCCGATTGATGAAATGCCAGGG + Intergenic
1114533840 14:23411013-23411035 CTCTGGTTGCTTAGGTGCCCTGG + Intergenic
1114633924 14:24177005-24177027 CACTGGGTGCTCAAGTGCCAGGG - Intronic
1115211511 14:30971273-30971295 CTCTGGTTGATGAAATGGCAGGG - Intronic
1115698090 14:35922393-35922415 CTCTGCTTGCTGAAGAGCAAAGG + Intronic
1117165384 14:53027836-53027858 CTCTGGTTTATGAAATTTCAGGG - Intergenic
1117179399 14:53176984-53177006 CTCTAGTTGATGAAATGCCAGGG + Intergenic
1117955106 14:61116769-61116791 CTCTGGTTGATGAAATGCCAGGG + Intergenic
1120212248 14:81644666-81644688 CTCTGGTTCAACAAGAGCCATGG + Intergenic
1121268761 14:92623620-92623642 TTCTGGTTGTTGAAATGCCAGGG + Intronic
1121741297 14:96254131-96254153 CTGTGCTTGATGAAGTCCCCTGG - Intronic
1124934316 15:34155992-34156014 CTCTGGTTGATGAAATGCCAGGG + Intronic
1125690462 15:41591952-41591974 CTCTTATTGATGAAATGCCAGGG - Intergenic
1127865070 15:63026066-63026088 ATTTGGTTGAGGAACTGCCATGG + Intergenic
1128691694 15:69729235-69729257 CTCTCGTTGAGGCAGTTCCAGGG + Intergenic
1129914170 15:79253912-79253934 CTCAGGTTGATGAGGGGTCAGGG + Intergenic
1130388984 15:83438302-83438324 ATCAGGTAGATAAAGTGCCATGG + Intergenic
1131261705 15:90891162-90891184 GACTGGATGATGAAGTGCCGGGG - Exonic
1132571746 16:647284-647306 CTCTGGTTCAGGAAGTGCCTAGG + Intronic
1133961035 16:10493562-10493584 CTCTGGTTGATGAAATGCCAGGG - Intergenic
1134608888 16:15592405-15592427 CTCTGGCTGCTGAAATACCAAGG + Intronic
1135974291 16:27097249-27097271 CTCTGGAGGATGCAGTGTCAAGG - Intergenic
1136415837 16:30103053-30103075 GTCTGGTTGATGAAATGCCAAGG - Intergenic
1136670460 16:31851907-31851929 TTCTGGTTGGTGAAATGCCACGG - Intergenic
1137051979 16:35722247-35722269 TTCTGGTTGATGAAATGCCAGGG + Intergenic
1137067422 16:35863110-35863132 CTGTGGTGGCTGCAGTGCCATGG + Intergenic
1138053883 16:53812188-53812210 CTCTGGTTGTAGAGGTGTCAGGG - Intronic
1138556860 16:57775878-57775900 CTCTGGCTGATGAGGAGCCTGGG - Intronic
1139091896 16:63658639-63658661 CTCTAGCTTATGAAGTGGCAGGG + Intergenic
1139313840 16:66050773-66050795 CTCTGGTGGCTGAACTGCCCAGG + Intergenic
1140119556 16:72071776-72071798 TTCTGGTTGATGAAATGCCAGGG - Intronic
1140295834 16:73708945-73708967 CCCTCGTTGATGAGGTGCCTGGG + Intergenic
1141351626 16:83303567-83303589 TTCTGGTTAATGAAGTTACAGGG + Intronic
1142728500 17:1833812-1833834 CTCTTGTTGCTGGAGTGCAATGG - Intronic
1143594728 17:7907411-7907433 CTCTAGAGGATGAGGTGCCAGGG + Exonic
1143798741 17:9359829-9359851 CTCTGGTTAATGAAATTTCAGGG + Intronic
1145110926 17:20160458-20160480 CTCTGCTTGATGCAGTCCCCTGG - Intronic
1146086124 17:29831609-29831631 CTCTTGTTGCTCAAGTGCAATGG + Intronic
1146106336 17:30040492-30040514 TTCTGGTTGATGAAATGCCAGGG - Intronic
1146764256 17:35504950-35504972 CTCTGGTTGATGAAATGCCAGGG - Intronic
1147324246 17:39662813-39662835 CTCTGGTGGATGAGGTACCGGGG - Exonic
1147810217 17:43163605-43163627 TTCTGGTTGATGAAATGCCAGGG + Intergenic
1148828872 17:50416118-50416140 TTCTAGTTGATGAAATGCCAGGG + Intergenic
1151743990 17:76001726-76001748 GTTTGGTGGATGACGTGCCAAGG + Intronic
1152455037 17:80410099-80410121 CTCTGGTTGATGGAATGCCAGGG - Intergenic
1153416236 18:4849125-4849147 CTCTGGTTAATGAAATTTCAGGG - Intergenic
1153826283 18:8878104-8878126 CTCTGGTTGATGAAATGCCAGGG + Intergenic
1153830464 18:8917931-8917953 CTCTGGTTGATGAAATGCCAGGG - Intergenic
1154014050 18:10600807-10600829 TTCTGGTTGATGAAATGCCAGGG + Intergenic
1154402669 18:14056555-14056577 CTGTGGTGGCTGCAGTGCCATGG + Intergenic
1154463369 18:14618567-14618589 CTCTGGTTGGTGAAATGCCAGGG - Intergenic
1154529597 18:15330695-15330717 CTCAGGTTGAGGAGGGGCCAGGG - Intergenic
1155746079 18:29357700-29357722 CGCTAGTTAATGAAATGCCAGGG + Intergenic
1156733409 18:40223567-40223589 CTCTGGTTAATGAAATTTCAGGG + Intergenic
1157562273 18:48656785-48656807 CCCCGGTTGCTGAAATGCCAAGG - Intronic
1158937600 18:62379001-62379023 ATCTGGATTATGACGTGCCATGG + Intronic
1162267672 19:9589229-9589251 CTCTGGTTGCTGAAATGCCAGGG + Intergenic
1162273297 19:9633653-9633675 GTTTGGCTGATGAAATGCCAGGG - Exonic
1163567038 19:18058111-18058133 CTCTTGTTGCTGGAGTGCAATGG - Intergenic
1163866998 19:19781899-19781921 CTCTGGTTGATGAAATGCCAGGG + Intergenic
1163991942 19:21006965-21006987 CTCTGGTTGATGAAATGCCAGGG - Intergenic
1164121476 19:22269261-22269283 CTCTTGTTGATGAAATGCCAGGG + Intergenic
1164130578 19:22357890-22357912 CTCTCGTTGATGAAATGCCAGGG + Intergenic
1164216871 19:23158255-23158277 TTCTGGTTGATGAAATGCCAGGG + Intergenic
1164513722 19:28917195-28917217 CACTGGTTGATGAGGAGTCAAGG + Intergenic
1167906974 19:52669186-52669208 CTCTGGTTGATGAAATGCCAGGG - Intronic
1167935371 19:52902010-52902032 TTCTGGTTGATGAAATACCAGGG + Intergenic
926491360 2:13529372-13529394 TTCTGGTTGATGAAATGCCAGGG + Intergenic
926503413 2:13681783-13681805 TTCTGGTTGATGAAATGCCAGGG - Intergenic
930101658 2:47608161-47608183 GTCTGGTAGAGGCAGTGCCAAGG + Intergenic
930877809 2:56239313-56239335 CTCTGGATGATGAAGCCCCAAGG + Intronic
932081040 2:68715473-68715495 CTCTGGCTAATGCAGTGCAATGG + Intronic
933389333 2:81651155-81651177 CTGTGGTTGATGAAATGCCACGG + Intergenic
935048511 2:99503277-99503299 CTCTGGTTGATGAAATGCCAGGG - Intergenic
935721401 2:105982512-105982534 CTCTGGTTGATGAAATGCCAGGG + Intergenic
935970670 2:108528045-108528067 TTCTGGTTGATGAAATGCCAGGG - Intergenic
936419509 2:112349840-112349862 TTCTGGTTGATGAAATGCCAGGG + Intergenic
937199677 2:120192200-120192222 GTCTGCTTGATGGAGTCCCATGG - Intergenic
939582590 2:143968132-143968154 CTGTGCAAGATGAAGTGCCATGG + Intronic
940023838 2:149184150-149184172 CTCTTGTTGCTGGAGTGCAATGG - Intronic
942343268 2:174972713-174972735 GTCAGGTTGATTCAGTGCCAAGG + Intronic
943408187 2:187514712-187514734 CTCTGGTTGATGAAATGCCAGGG - Intronic
943708910 2:191067399-191067421 CTCTGGTTAATGAAATTTCAGGG - Intronic
943778068 2:191789416-191789438 CTCTGATTGATGAAATGACAAGG + Intergenic
945289827 2:208116105-208116127 CTCTGGTTGACAAAATCCCAGGG - Intergenic
945720378 2:213411166-213411188 CTCTGGTTGTTGAAATGCCAGGG - Intronic
946354812 2:219178091-219178113 TTCTGGTTGACGAAGTACCCCGG - Exonic
946874923 2:224119086-224119108 TTCTGTTTGATTAAGTCCCATGG - Intergenic
947206490 2:227666058-227666080 AGCTGGCTGATGAGGTGCCAAGG - Intergenic
947301473 2:228692272-228692294 CTCTGGATGATTAAGTGTGAGGG + Intergenic
947556460 2:231097806-231097828 CTCTGGTTGATGAAATGCCAGGG + Intronic
948875765 2:240827024-240827046 GGCTGTGTGATGAAGTGCCATGG + Intergenic
1168824378 20:799602-799624 CTCTGGTTGATGAAATGCCAGGG - Intergenic
1168850907 20:976357-976379 CTCTGGATGGTGAAGTGCTCAGG + Intronic
1169265657 20:4165851-4165873 CTCTGGTTGCTGAGGGGGCATGG + Intronic
1170348541 20:15414965-15414987 CCCTGGTTCACAAAGTGCCATGG - Intronic
1170401011 20:15983314-15983336 CTCTGGTTGATGAAATGCCAGGG + Intronic
1172102713 20:32495179-32495201 CTGTGGCTGAGGAAGTGCCCAGG - Intronic
1173484323 20:43429226-43429248 CTCTCGTTGCTGGAGTGCAACGG + Intergenic
1174047963 20:47747396-47747418 CTCTGGTTGCAGAAGTTCCTGGG + Intronic
1175136539 20:56828529-56828551 CTCTGATTGGTCAAGAGCCAAGG - Intergenic
1175513790 20:59554981-59555003 TTCTGGTTGATGAAATGCCAGGG + Intergenic
1175707283 20:61189750-61189772 TTTTGGTTGATGAAATGCCAGGG + Intergenic
1175895700 20:62334714-62334736 CTCTGGATGATGGAGAGTCAGGG + Intronic
1176126569 20:63478146-63478168 CTCTGCTTGATGCTGTGCCGTGG + Intergenic
1176811157 21:13539805-13539827 CTCTGGTTGGTGAAATGCCAGGG + Intergenic
1178667529 21:34562025-34562047 CTCTGGTTAATGCAGTCACATGG - Intronic
1179670788 21:42946160-42946182 GTCTTATTGATGAAATGCCAGGG + Intergenic
1180432369 22:15264077-15264099 CTCAGGTTGAAGAGGGGCCAGGG + Intergenic
1180514933 22:16132015-16132037 CTCAGGTTGAAGAGGGGCCAGGG + Intergenic
1180868194 22:19131694-19131716 CTCGAGTTCATCAAGTGCCAGGG + Exonic
1181318319 22:21985458-21985480 CTCTGCTTCCTGAAGTCCCATGG - Intergenic
1181505962 22:23357375-23357397 CTCTGGTTGATGAATTGCCAGGG - Intergenic
1184064037 22:42105717-42105739 TTCTGGCTGATGAAACGCCAGGG + Intergenic
1184662254 22:45970809-45970831 CCCAGGCTGATAAAGTGCCAGGG - Intronic
949953943 3:9252128-9252150 ATCTGGTTGATGAAGAGTCTGGG + Intronic
950594160 3:13964297-13964319 CTCTAGTTGATGAAATGCCAGGG + Intronic
950601584 3:14040193-14040215 GTTTGGTTGATGAAATTCCAGGG + Intronic
950846002 3:16016811-16016833 TTCTGGTTGATGAAATGCCAGGG + Intergenic
951248461 3:20367385-20367407 TTCTGGTTGATGAAATGCCAGGG + Intergenic
951953148 3:28224159-28224181 ATCTGGCTGATCAAGTGCAAGGG - Intergenic
952014012 3:28935378-28935400 CTCTCATTCATGAAGTGACAAGG - Intergenic
954090124 3:48277531-48277553 CTCTGGTTGATGAAATGCCAGGG - Intronic
954586582 3:51741859-51741881 TTTTGGTTGATGGAATGCCAGGG - Intergenic
954604884 3:51901585-51901607 CTCTGGTTGATGAAATGCCAGGG - Intronic
954907500 3:54075315-54075337 TTTTGGTTGATGAAATGCCGTGG - Intergenic
956740772 3:72274047-72274069 TTCTGGTTGATGAAGAGGTAAGG + Intergenic
956996100 3:74827924-74827946 CTCTGGTTGATGAAATGCCAGGG - Intergenic
957691750 3:83579937-83579959 CCCTGGTTGATGAGATTCCATGG + Intergenic
957989092 3:87608337-87608359 TTTTGGTTGATGAAATGCTAGGG + Intergenic
957999827 3:87736977-87736999 CTCTGGTTGATGAAATGCCAGGG + Intergenic
959661859 3:108878019-108878041 CTCTGCTTGATAAATTGCCTAGG - Intergenic
960659747 3:120044461-120044483 CTCTGCTTGATGAAATGCCAGGG - Intronic
960707549 3:120495043-120495065 GTCTGGTTGATGAAATGCCAAGG - Intergenic
960720224 3:120618239-120618261 CTCTGGCTGATGAAATGCCAGGG + Intergenic
962096657 3:132299487-132299509 CTCTGGTTGATAAAATGCCAGGG + Intergenic
962097462 3:132306989-132307011 CTCTGGTTTTTGAAATGCCAGGG - Intergenic
962277156 3:134024209-134024231 TTCTGGTTGATGAAATGCCAGGG - Intronic
963442230 3:145355217-145355239 TTCTGGTTGATGAAATGCCAGGG + Intergenic
964404787 3:156338143-156338165 ATCTGGTTGATCAAGTTCCAAGG + Intronic
964451069 3:156813958-156813980 CTCTGGTGTATGAAGTGCGTAGG - Intergenic
964611907 3:158624247-158624269 TTCTGGTTGATGAAATGCCAGGG + Intergenic
964932931 3:162047940-162047962 CTCTGATTGATGAAATGCCAGGG + Intergenic
965323396 3:167273729-167273751 TTCTGGTTGATGAACTGCCAGGG - Intronic
967282255 3:187833792-187833814 CTCTGGTTGAGGGAGGGGCAAGG + Intergenic
970398447 4:15695243-15695265 TTCTGGTTGATGAAATGTCAGGG + Intronic
971027393 4:22601988-22602010 CTCTGGTTGATGAAATGCCAGGG - Intergenic
971680794 4:29698074-29698096 CTCTTGTTGCTGGAGTGCAATGG + Intergenic
972217141 4:36909956-36909978 TTCCAGTTGATGAAATGCCAGGG - Intergenic
972275031 4:37549321-37549343 TTCTGGTTGATGAAATGCCAGGG - Intronic
972785122 4:42319368-42319390 CTCTGGTTGATGAAATGCCAGGG - Intergenic
972991137 4:44823520-44823542 CTCTGGTTGATGAAATGCCAGGG + Intergenic
974118097 4:57605727-57605749 CTCTGCTTCATTAAGTTCCATGG + Intergenic
974849828 4:67391111-67391133 CTCTGGTTGATGAAATTCCTGGG - Intergenic
974949746 4:68573623-68573645 CTCTGGTTGATGAAATGCCAGGG + Intronic
975205735 4:71642568-71642590 CTCTGGTTGATGAAATGCCAGGG - Intergenic
975270756 4:72430163-72430185 CTCTTGATGAGGGAGTGCCAAGG - Intronic
975862220 4:78689875-78689897 CTCTTGTTGCTGGAGTGCAATGG + Intergenic
975911860 4:79276705-79276727 CTCTGGTTGATGAAATGCCAGGG - Intronic
976990245 4:91356546-91356568 CTCTGGCTGATGAAATGCCAGGG + Intronic
977043478 4:92041815-92041837 CTCTGGTTGATGAAATGCCAGGG + Intergenic
977454594 4:97242419-97242441 CTTTGGGTGATGATATGCCAAGG + Intronic
977609126 4:99014676-99014698 TTTTTGTTGATGAAATGCCAGGG + Intronic
977972472 4:103228032-103228054 CTCCGGTTGATGAAATGCCAGGG - Intergenic
978311297 4:107387266-107387288 TTCTGGTTGATGAAACGCCAGGG - Intergenic
978314315 4:107418643-107418665 CTCTGGTTGATGAAATTCCTTGG - Intergenic
979052565 4:115953390-115953412 TCCTGGTTGATGAAATGCCAGGG - Intergenic
980073091 4:128264247-128264269 CTCTGGTTGATGAAATGCCAGGG - Intergenic
980438661 4:132813845-132813867 TTCTGGTTGATGAAATGCTAGGG + Intergenic
982626751 4:157777047-157777069 TTCTTGTTGATAAAGTTCCAGGG - Intergenic
982662679 4:158225598-158225620 TTCTGGTTGATGAAATGCCAGGG + Intronic
983708525 4:170687420-170687442 CTCTGGTTGATGAAATGCTGGGG - Intergenic
983898062 4:173102834-173102856 TTCTGGTTGATGAAATGCCAGGG - Intergenic
986070714 5:4279806-4279828 CTTTGCTTGATTAAGTGCCAGGG - Intergenic
986146441 5:5082487-5082509 CTCTGGTTAATGAAATTTCAGGG - Intergenic
986237529 5:5926016-5926038 CACTAGTTCATGAAGTGCCCTGG - Intergenic
987930449 5:24394235-24394257 CTCTGGTTGATGAAATGCCAGGG + Intergenic
988959477 5:36355345-36355367 CTCTGGTTTTTGAGGTGCAATGG - Intergenic
989095956 5:37781488-37781510 TTCTGGTAGATAAAATGCCAGGG + Intergenic
989557679 5:42816343-42816365 CTCTGGTTGATGAAATGCCAGGG - Intronic
989613390 5:43316464-43316486 CTCTGGTTGATAAAATGCCAAGG + Intergenic
990318302 5:54605046-54605068 CTCTGGTGGAGGAAGTGTGAGGG + Intergenic
991153593 5:63401617-63401639 CTCTGGTGGATAAACTGACAAGG - Intergenic
991216359 5:64160769-64160791 TTCTGGTTGATGAAATGCCAGGG - Intergenic
991306165 5:65178220-65178242 CTCTGATTGATGAAATGTCAGGG - Intronic
992989602 5:82270688-82270710 CTCTGGTTGATGAAATGCCAGGG + Intronic
993054891 5:82970380-82970402 CTCTGGTTGATGAAATGCCAAGG + Intergenic
993169325 5:84397033-84397055 TGCTGGTTGTAGAAGTGCCAGGG - Intergenic
994211734 5:97094789-97094811 CACTGGGTGAGGAAGTGTCAGGG + Exonic
995825098 5:116288116-116288138 CTCTAGGTGATGAACTCCCATGG + Intronic
995867515 5:116707268-116707290 TTCTGGTTGATGAAATGCCAGGG - Intergenic
997197259 5:131988423-131988445 CTCTGCTTGAGGAGGTTCCATGG - Intronic
997507480 5:134429366-134429388 CTCTGGTTAATGAAATTTCAGGG + Intergenic
997692621 5:135837011-135837033 TACTGGTTTGTGAAGTGCCAAGG + Intronic
998114804 5:139528317-139528339 TTTTGGTTGATGAAATGCCAGGG - Intronic
998552350 5:143089884-143089906 TTCTGGTTGATGAAATGCCAGGG + Intronic
998938487 5:147255988-147256010 CTTTGGTTGATGAAATGTCAGGG + Intronic
999232893 5:150072452-150072474 CTCTTGTTGCTGGAGTGCAATGG - Intronic
999443800 5:151622783-151622805 CTGTGGTTGAGCAAGTCCCATGG + Intergenic
999785309 5:154884880-154884902 GTTTGGTTGGTGAAATGCCAGGG - Intergenic
1000236911 5:159370456-159370478 CTCTGGTTGATGAAATGCCAGGG - Intergenic
1000395174 5:160767259-160767281 CTCTGATTGCTCAAGTGACATGG - Intronic
1000554217 5:162704230-162704252 CACTGGTTGATGTAGAGCAATGG + Intergenic
1000604805 5:163316474-163316496 CTCTGGTTGATGAAATGCCAGGG + Intergenic
1001558347 5:172651907-172651929 CACTGGTTGATGAAATGCCAGGG + Intronic
1002102539 5:176864555-176864577 CTCTGGATGAGTAAGAGCCAAGG - Intronic
1002614580 5:180442869-180442891 CTCTGGAAGATGAAGTAACAGGG + Intergenic
1002999025 6:2313802-2313824 CTCTGGTTGATAAAATGCCAGGG + Intergenic
1005462028 6:26078333-26078355 CTCTGGTTGATGAAATGCTAGGG - Intergenic
1005575452 6:27185367-27185389 GTCTGGTTGATGAAATGCCAAGG - Intergenic
1006032083 6:31183863-31183885 CTCTGGTTGATGAAATGCCAGGG + Intergenic
1006325685 6:33352097-33352119 CTCTCGTTGATGAAATAACAGGG + Intergenic
1007500230 6:42291301-42291323 CACTGGTTTTTGAAGGGCCAAGG + Intronic
1008123559 6:47644762-47644784 CTCTGGTTGATGAAATGCCAGGG - Intergenic
1009635900 6:66263574-66263596 CTCTGGTTGATGAAATGCTAGGG - Intergenic
1010317847 6:74471180-74471202 CTCTGGTAGATGAAATGACAGGG - Intergenic
1011211847 6:84964130-84964152 TTCTGGTTGATGAACTGCCAGGG + Intergenic
1011500605 6:87985030-87985052 CTCTTGTTGCTGGAGTGCAATGG + Intergenic
1011518156 6:88174960-88174982 CTCTTGTTGCTGCAGTGCAATGG - Intergenic
1011570505 6:88729362-88729384 TTCTGGTTGATGAAATGCCAGGG - Intronic
1013508336 6:110821050-110821072 CGCTGGTTAATGAAATTCCAGGG + Intronic
1013559207 6:111287606-111287628 CTCTGGTTGATGAAATGCCAGGG + Intergenic
1014111290 6:117620641-117620663 TTCAGATTGATGAAATGCCAGGG - Intergenic
1014307963 6:119766061-119766083 TTCTGGTTGGTGAAATGCCAGGG + Intergenic
1015172015 6:130264529-130264551 CTCTGGTTGATGAAATGCCAGGG - Intronic
1017902800 6:158732866-158732888 TTTTGGTTGATGAAATGCCAGGG - Intronic
1018143043 6:160858819-160858841 CTCTGGTTGGTGGGGTGGCAGGG - Intergenic
1018152427 6:160952835-160952857 CTCTTGTTGCTGGAGTGCAATGG - Intergenic
1018191239 6:161310923-161310945 CTCTAGTTGATGAAATGCCAGGG + Intergenic
1020043800 7:5024583-5024605 TTCTGGTTGATGAAATGCCAGGG + Intronic
1020655877 7:10927465-10927487 CTCTGGTTGATGAAATGCCAGGG - Intergenic
1020745539 7:12074128-12074150 TTCTGGTTGATGAAATGCCAGGG - Intergenic
1021355755 7:19651612-19651634 CTCTTCTTGGTGAAGAGCCAGGG - Intergenic
1021849267 7:24791654-24791676 TTCTGGTTGATGAAATGCCAGGG + Intergenic
1023397028 7:39760728-39760750 TCTTGGTTGATGAAATGCCAAGG - Intergenic
1023799202 7:43818748-43818770 CTCTGGTTGATGAAATGCCAGGG - Intergenic
1023799640 7:43822668-43822690 CTCTGGTTGATGAAATGCCAGGG - Intergenic
1024813028 7:53235653-53235675 TTCTGGCTGATGAAATGCCAGGG - Intergenic
1024987881 7:55211801-55211823 CTCTGGTTCCTGAGGTGCGATGG - Intronic
1026489295 7:70848875-70848897 CTCAGGTTGATGAAATACAAGGG - Intergenic
1027874621 7:83752823-83752845 CTCTGGTGGATGTAGTAACAAGG + Intergenic
1028334114 7:89629711-89629733 CTCTGGTTGATAAAATTCCAGGG - Intergenic
1028427115 7:90702011-90702033 CTCTGGCTGAAAAAGTCCCAGGG + Intronic
1028793840 7:94882113-94882135 CTCTGACTGATGAAATGCAAGGG - Intergenic
1029201459 7:98841983-98842005 ATCTAGGAGATGAAGTGCCAGGG - Intergenic
1029486184 7:100843183-100843205 CTCTGGTTGATGAAATGCCAGGG - Intronic
1030165565 7:106551807-106551829 CTCTTGTTGATCAGCTGCCATGG + Intergenic
1031895443 7:127342390-127342412 CTCTGGGTAATGAAGTTACAGGG + Intergenic
1032170639 7:129581817-129581839 CTCTGTTTGATGAAATGCCAGGG - Intergenic
1032782397 7:135174376-135174398 CTCTTGTTGATGAAATGTCAGGG - Intergenic
1032979480 7:137265293-137265315 TTCTGGTTGATGAAATGCCAGGG + Intronic
1033096918 7:138440399-138440421 CTCTGGTTGATGAAATGCCAGGG + Intergenic
1033119731 7:138657000-138657022 CTCTTGTTGCTGGAGTGCAATGG - Intronic
1033176025 7:139124497-139124519 CCCTGGTTGATAAGGTTCCAGGG - Intergenic
1034100909 7:148449642-148449664 CTCTGGTTAATGAAATTTCAGGG - Intergenic
1034784131 7:153909832-153909854 CCCTGGTTGATGAAGTTCTAGGG - Intronic
1036104280 8:5823707-5823729 CTCTGTTTGATGAAATGCAAGGG + Intergenic
1037554373 8:20007997-20008019 CCCTGGTTGATGAAATTCCTTGG - Intergenic
1038089753 8:24239900-24239922 CTCTAGTTGATGAAATGCCAGGG - Intergenic
1038242068 8:25819015-25819037 CTCTGTTGGCTGAAGTGCGATGG - Intergenic
1038455425 8:27669476-27669498 CTCTGGCTGCTGAGCTGCCAGGG + Intronic
1039110466 8:34035933-34035955 CTCTGGTGTGTGAGGTGCCAAGG - Intergenic
1040469976 8:47728912-47728934 CTCTGGTATATGAAAAGCCAAGG - Exonic
1040983347 8:53268094-53268116 GTTTTGTTGATGAAATGCCAGGG + Intergenic
1040993317 8:53375493-53375515 CTCTGGTTGATGAAATGCCAGGG + Intergenic
1041227222 8:55712627-55712649 TTCTGGTTGATGAAATGCCAGGG - Intronic
1041515557 8:58695438-58695460 TTCTGGCTGATGAAATGCCAGGG - Intergenic
1042087755 8:65127500-65127522 CTCTGGTTGATGAAATGCCAGGG + Intergenic
1042108931 8:65358157-65358179 CTCTGAGTGATGAAGTTCAAGGG - Intergenic
1043331561 8:79123315-79123337 GTTTGGTTGATAAAATGCCAGGG - Intergenic
1044184451 8:89235457-89235479 CTCTGGTTGATGAAATGCCAGGG + Intergenic
1045240199 8:100393635-100393657 CTGTGATTTATGAAGTGCAAAGG + Intronic
1046076224 8:109315380-109315402 CTCTGGTTAATGAAATTTCAGGG - Intronic
1046260242 8:111758696-111758718 CCCTAGTGGATCAAGTGCCAGGG + Intergenic
1047116685 8:121850197-121850219 TTCAGGTTGATGACCTGCCACGG + Intergenic
1049289683 8:141795203-141795225 CTCTGGTGGGTGAAGGCCCAAGG - Intergenic
1049633969 8:143676022-143676044 CTCTGGTTGATGAAATGCCAGGG - Intergenic
1050480986 9:6086558-6086580 TTCTGGTTGATGAAATATCAGGG - Intergenic
1052508176 9:29381483-29381505 CTCTGATTGATGAAATGCCAGGG - Intergenic
1052990287 9:34514972-34514994 CTCTGGGGGATGAGATGCCATGG + Intronic
1053110595 9:35456661-35456683 TTCTGGTTGATGAAATGCCAGGG + Intergenic
1053517308 9:38741881-38741903 CTATAGTTGCTGAAATGCCAGGG + Intergenic
1053707311 9:40768477-40768499 CTCAGGTTGAGGAGGGGCCAGGG - Intergenic
1054417227 9:64889245-64889267 CTCAGGTTGAGGAGGGGCCAGGG - Intergenic
1054858524 9:69926575-69926597 TTCTGGTTGATGAAATGCCAGGG + Intergenic
1056414328 9:86361840-86361862 CTCTGGTTGATGAAATGCCAGGG + Intergenic
1056599897 9:88038666-88038688 TTCTGGTTGAAGAAATGCAAGGG + Intergenic
1057988437 9:99741898-99741920 CTGTGGATGATGAAGAGCCATGG + Intergenic
1058212388 9:102185499-102185521 CTCTGGCTGTTAAAGAGCCATGG + Intergenic
1058594613 9:106602046-106602068 CTCTTGTTGCTTAGGTGCCAAGG + Intergenic
1059463262 9:114448861-114448883 CTGTGGGTGAGGAAGTGACAAGG - Intronic
1061829165 9:133279821-133279843 GTCTGGTTGTTGAAATGCCAAGG + Intergenic
1186523942 X:10230435-10230457 CTCTGGTTGATTGATTGCAATGG + Intronic
1186558628 X:10587166-10587188 TGCTGGTTGATGAAATGCCAGGG + Intronic
1189034695 X:37483524-37483546 CTCTGGTTGATGAAATGCCAGGG - Intronic
1189483744 X:41413086-41413108 CTCTTGTTGCTGGAGTGCAATGG + Intergenic
1189833724 X:45000421-45000443 CTCTGGTTGATGAAGTGCCAGGG + Intronic
1189833730 X:45000447-45000469 AAGGGGTTGATGAAGTGCCAGGG + Intronic
1189898773 X:45684096-45684118 GTCAGGTTTATGAACTGCCAAGG - Intergenic
1190270358 X:48858385-48858407 CTCTGGTTGATGAAATGCCAGGG - Intergenic
1190771311 X:53517035-53517057 CTCTGGTTGATGAAATGCCAGGG - Intergenic
1191639324 X:63413295-63413317 TTCTGGTTGATGAAATTCCAAGG - Intergenic
1191682269 X:63853284-63853306 CTCTATCTGATGTAGTGCCAAGG - Intergenic
1191719950 X:64221163-64221185 CTCTGGTTTCTGGAGTCCCATGG + Intergenic
1191889827 X:65928541-65928563 CTCTGGTTGATGAAATGCCAGGG + Intergenic
1191917884 X:66221961-66221983 CTATGGTTGATGAAATGCCAGGG + Intronic
1192213188 X:69140545-69140567 CTCTGGCTGATGATGACCCAGGG - Intergenic
1192681492 X:73258233-73258255 TTCTGGTTGATGAAATGCCAGGG + Intergenic
1192915381 X:75646084-75646106 CTCTGGTTGATGAAATGCCAGGG + Intergenic
1193717418 X:84949050-84949072 CTCTGGTTGATGAAATGCCAGGG - Intergenic
1194366578 X:93020403-93020425 CTTTGGTTTTTGAATTGCCAGGG - Intergenic
1194779618 X:98009145-98009167 CTCTGGAGGATGAAGTGACAAGG - Intergenic
1195565832 X:106338386-106338408 CTCTGGTTAAAGAAGAGTCAAGG - Intergenic
1195846715 X:109237191-109237213 CTCTGGTTGATGAAATGCCAGGG + Intergenic
1196422916 X:115541135-115541157 TTCTGGTTGATGAAATGCCAGGG + Intergenic
1196459995 X:115919842-115919864 CTCTGGTTGATGAAATGCCAGGG + Intergenic
1196869493 X:120099357-120099379 CTCTGGTTGATGAAATGCCAGGG - Intergenic
1198693116 X:139306146-139306168 CTCTGGATGATGCAGTATCAAGG - Intergenic
1198742570 X:139856549-139856571 TCCTGGTTGATGAAATGCCAGGG - Intronic
1199638440 X:149835832-149835854 CTCTGGTTGATGAAATGCCAGGG - Intergenic
1200763128 Y:7058101-7058123 CTCTGGTTGATGAAATGCCAGGG + Intronic
1200769374 Y:7109304-7109326 CTCTTGTTGATGAAATGCCAGGG - Intergenic
1201259998 Y:12149602-12149624 TTCTGGTTGATGAAATGCCAGGG + Intergenic
1201308999 Y:12577496-12577518 CTCTGGTTGAGGAAATGCCATGG - Intergenic
1201318358 Y:12670484-12670506 CTCTGGTTAAAGAAGAGTCAAGG - Intergenic
1201372957 Y:13285289-13285311 CTCTGGTTGATTAAATGCCAGGG - Intronic
1201972230 Y:19810653-19810675 TTCCGGTTGATGAAATGCCAGGG + Intergenic