ID: 1071292069

View in Genome Browser
Species Human (GRCh38)
Location 10:84195349-84195371
Sequence CCCCAACCCAAGTGCACCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 105}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071292069_1071292074 7 Left 1071292069 10:84195349-84195371 CCCTCGGTGCACTTGGGTTGGGG 0: 1
1: 0
2: 1
3: 3
4: 105
Right 1071292074 10:84195379-84195401 GCGCCCTCCTGCCCAGTAGCTGG 0: 1
1: 0
2: 0
3: 16
4: 565
1071292069_1071292075 8 Left 1071292069 10:84195349-84195371 CCCTCGGTGCACTTGGGTTGGGG 0: 1
1: 0
2: 1
3: 3
4: 105
Right 1071292075 10:84195380-84195402 CGCCCTCCTGCCCAGTAGCTGGG 0: 1
1: 0
2: 1
3: 57
4: 944
1071292069_1071292083 29 Left 1071292069 10:84195349-84195371 CCCTCGGTGCACTTGGGTTGGGG 0: 1
1: 0
2: 1
3: 3
4: 105
Right 1071292083 10:84195401-84195423 GGCCTGACGCGGGACCGCGCTGG 0: 1
1: 0
2: 0
3: 3
4: 74
1071292069_1071292080 18 Left 1071292069 10:84195349-84195371 CCCTCGGTGCACTTGGGTTGGGG 0: 1
1: 0
2: 1
3: 3
4: 105
Right 1071292080 10:84195390-84195412 CCCAGTAGCTGGGCCTGACGCGG 0: 1
1: 0
2: 0
3: 15
4: 295
1071292069_1071292082 19 Left 1071292069 10:84195349-84195371 CCCTCGGTGCACTTGGGTTGGGG 0: 1
1: 0
2: 1
3: 3
4: 105
Right 1071292082 10:84195391-84195413 CCAGTAGCTGGGCCTGACGCGGG 0: 1
1: 0
2: 2
3: 18
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071292069 Original CRISPR CCCCAACCCAAGTGCACCGA GGG (reversed) Intronic
902569128 1:17335747-17335769 CCCCACCCCAAGGTCACTGAGGG + Intronic
902719053 1:18292081-18292103 TCCAAGCCCAAGAGCACCGAGGG - Intronic
904274368 1:29370675-29370697 CCCCAACCCCAGCTCACCGTGGG - Intergenic
905243971 1:36599611-36599633 CCCCAACCTAACTGCAAGGAAGG - Intergenic
907588686 1:55645258-55645280 TCCAAACCAAATTGCACCGAGGG + Intergenic
921156693 1:212444608-212444630 CACCATACCAAGTGGACCGAAGG - Intronic
1063252009 10:4284050-4284072 CCTCGACCCGATTGCACCGAGGG + Intergenic
1065021629 10:21506726-21506748 CTCCAGCCCCAGTGCACGGAAGG - Intergenic
1069565661 10:69461745-69461767 CCCCAACCCTACTGCACCCAGGG - Intronic
1070836865 10:79452987-79453009 CCCCAGCCCAGGGGCACAGAAGG + Intergenic
1070956217 10:80465194-80465216 CCCCCACCCAAGGGCACAGCTGG - Intronic
1071292069 10:84195349-84195371 CCCCAACCCAAGTGCACCGAGGG - Intronic
1072576086 10:96701453-96701475 CACAACCCCAAGTGCACAGATGG - Intronic
1073289802 10:102407988-102408010 CCCCAGGCCAACTGCACAGAGGG - Intronic
1074431298 10:113397163-113397185 CACCAGCCCACGTGCACTGAGGG - Intergenic
1074498122 10:113997611-113997633 CCCTAGACCAAGTGCACCGAGGG + Intergenic
1076891500 10:133286543-133286565 CACCACCCCAACAGCACCGAGGG + Intronic
1077415742 11:2423494-2423516 CCTCTACCCAGGTGCACCCAGGG - Intergenic
1077486204 11:2839443-2839465 CCCCAACCCAGATGCAGGGAGGG + Intronic
1078599177 11:12715475-12715497 CCCCCACCCAGGTGAAACGAAGG - Intronic
1085015579 11:73171954-73171976 CCCCAGCCCGAGTGCTCCCAGGG - Intergenic
1089073485 11:115718543-115718565 CACCTACCCAAGTGCAGCGGGGG - Intergenic
1089226198 11:116924692-116924714 CCCCACCCCAACTACACCCAAGG + Intronic
1091293540 11:134456274-134456296 ACCCACCCCAAGTGCAGAGAAGG - Intergenic
1092194137 12:6539022-6539044 CCCCTACCCAAGTTCCCCTAAGG - Intronic
1096177948 12:49535364-49535386 CCCCAACCCACATGCACAAAGGG - Intergenic
1101251412 12:102939532-102939554 CCCCAGCCCAAGAGCAGCAAGGG - Intronic
1103580117 12:121908601-121908623 CCCCCACCAAAGTGCTCCCAAGG - Intronic
1111626726 13:90797556-90797578 CCCCAACCCAAGTCCCATGAGGG + Intergenic
1112505930 13:99975547-99975569 CCCCAGCCCAAGGGCGCCAATGG + Intergenic
1113802667 13:113094649-113094671 CCCCACCCCAAGTGCCCACAGGG - Intronic
1122996210 14:105266271-105266293 CCCCATCTCTAGTGCACCTATGG + Intronic
1123112935 14:105881490-105881512 CCCCATCCCAAGTCAGCCGAAGG - Intergenic
1129193639 15:73951921-73951943 CCCCAACCCACAGGCACGGAGGG + Exonic
1129756738 15:78103371-78103393 CCCCAACCCAAGGTCAATGAGGG + Intronic
1130537643 15:84798576-84798598 CCCCATCCCCAGAGCACCCACGG + Exonic
1130907603 15:88251554-88251576 CCCCATCCCATGTGCTCCCATGG - Intronic
1133435931 16:5779696-5779718 CCCCAACCCAAGTGGAATGATGG + Intergenic
1139472391 16:67185125-67185147 CCCCAACCCACCTGAACCGTGGG + Exonic
1139651355 16:68363760-68363782 CCCCAGCCCCAGCTCACCGATGG + Exonic
1139801126 16:69523779-69523801 CCCCAACCCACGCTCACAGATGG + Intergenic
1141234281 16:82201086-82201108 CCCTGACCCAAGTGCATCTACGG + Intergenic
1141625217 16:85258051-85258073 CCCCATCCCCAGTGCCCCCATGG + Intergenic
1141927744 16:87180064-87180086 CCCCCACCCATGTTCTCCGAGGG - Intronic
1142717313 17:1754363-1754385 CCCCAACCCCAGTGCACCGCGGG + Exonic
1142718669 17:1762339-1762361 CCCAAATCCCACTGCACCGACGG + Intronic
1142901181 17:3012723-3012745 CCCCAACCCCAGTGGCCCCATGG - Intronic
1146400141 17:32495229-32495251 CCCCAGCCCTGGTACACCGAAGG - Intronic
1152130947 17:78476133-78476155 CTCCACCCCAAGTGGACAGAGGG + Intronic
1152564280 17:81093191-81093213 TCCTAACCCATGTGCACTGAGGG + Intronic
1152763015 17:82119435-82119457 CCCCCACCCCTGTGCACCTACGG + Intronic
1152763079 17:82119674-82119696 CCCCAACCCCTGTGCACCTGTGG - Intronic
1153150583 18:2088132-2088154 CCTCAATCCCAGTGCACAGAAGG + Intergenic
1159080015 18:63726196-63726218 CTCCAACCCAAATCCACAGAAGG + Intronic
1160550592 18:79691900-79691922 CCCCACCCCAAGTCCACCCTGGG - Intronic
1166280267 19:41787940-41787962 ACCCACCCCAAGTGCATGGAGGG + Intergenic
1166396474 19:42444786-42444808 ACCCACCCCAAGTGCATGGAGGG - Intergenic
1166412451 19:42564997-42565019 ACCCACCCCAAGTGCATGGAGGG - Intergenic
1166783227 19:45352965-45352987 CCCCAGCCTAGGTGCACAGAGGG - Intronic
939362017 2:141184728-141184750 CCTCAGCCAAAGTGCAGCGATGG + Intronic
947625159 2:231614326-231614348 CCCCCACCCAGGCGCCCCGATGG + Intergenic
948831087 2:240598575-240598597 CCCCACCCCGAGTGCAGCCAGGG - Intronic
949010154 2:241673611-241673633 CCCCACCCCAACTACACCCAAGG - Exonic
1170379715 20:15743681-15743703 CTCAAACACAAGTGCAGCGAGGG - Intronic
1170693332 20:18634868-18634890 CCCCATCACAGGTGCACAGAGGG + Intronic
1173025499 20:39303920-39303942 GCCCAACCCAAGTGCAAGGGGGG + Intergenic
1173362318 20:42355697-42355719 CACCAACCCCAGTGCACCAGTGG + Intronic
1175206674 20:57316791-57316813 CCCCAGCCCCAGTGGACCCATGG + Intergenic
1179647918 21:42786402-42786424 CCCCAACACAGCTGCAGCGATGG - Intergenic
1179794104 21:43772590-43772612 CCCCAACCCAGGTGCCCCATAGG + Exonic
1180170790 21:46057137-46057159 CCCCGACACAAGTGCACCCCCGG - Intergenic
1182352031 22:29704538-29704560 CCCCATCCCCAGTTCACCCACGG - Intergenic
953657052 3:44862198-44862220 CCCCACCCCAAGAGCCCCGCGGG - Intronic
955393218 3:58536217-58536239 CCCTAACCCTAGAGCACCCAGGG - Intronic
956654551 3:71536348-71536370 CCCCTACCCAAATGCTCAGAGGG + Intronic
958594321 3:96201773-96201795 CCCCAGCCTAAGGGCACCAAGGG - Intergenic
959689874 3:109187406-109187428 CACTAACTCAAGTGCACGGAAGG + Intergenic
961455573 3:127022347-127022369 CCCCAACCCCAGTGCCCCCCAGG - Intronic
968656358 4:1780032-1780054 CCCGAACCCCAGGGCAGCGAGGG - Intergenic
968943396 4:3651152-3651174 ACCCAACCCAAATGCTCTGAAGG + Intergenic
970655755 4:18228658-18228680 CCCCACCCCAAGTCCTCCAAAGG + Intergenic
971845978 4:31917925-31917947 CCCCAATGCAAGTGCACTGTAGG - Intergenic
990881203 5:60541241-60541263 CCCCAGCCCTAGTCCACAGAGGG + Intergenic
993246429 5:85458890-85458912 CCCCAGCCCAAGAGCAGCAAGGG + Intergenic
993794582 5:92250155-92250177 CCCCAGTCCAAGTGCAGCAAGGG - Intergenic
997362604 5:133304852-133304874 CCAGAACCCCAGTGCACAGATGG + Intronic
1010644064 6:78365287-78365309 CCCCATCGCAAGTCCAACGAAGG + Intergenic
1015771128 6:136769705-136769727 ACCCAACCAATGTGCACTGAAGG + Intronic
1022038797 7:26559605-26559627 GCCCAACCCAAATCCATCGATGG - Intergenic
1022816477 7:33919042-33919064 CCCCCACACACGTGCACCCATGG - Intronic
1027336244 7:77153501-77153523 CACCAACCCAAATGTACAGATGG + Intronic
1029779544 7:102717601-102717623 CACCAACCCAAATGTACAGATGG - Intergenic
1031418603 7:121522426-121522448 CCCCAACAAAATTGCACCAAAGG - Intergenic
1031548228 7:123076771-123076793 CCCCAACCCCAGTGCATACAAGG + Intergenic
1032521125 7:132546041-132546063 CACCAACCCAAATGCTCAGAAGG + Intronic
1038413839 8:27378777-27378799 CCCCACCCCAAGTGGAGCTAGGG + Intronic
1039907606 8:41798095-41798117 TCCCAACCCAGGGGCACCCAGGG - Intronic
1043856961 8:85275080-85275102 CCCCAGCCTAAGTGCACTGTGGG - Intronic
1049042543 8:140123563-140123585 CCCCACCCCAACTGCACAGCTGG + Intronic
1050416267 9:5420578-5420600 GGCCAACACAAGTTCACCGAGGG - Intronic
1057017328 9:91664100-91664122 CCCCATCCCAAAGGCACCAAAGG + Intronic
1057579249 9:96271472-96271494 GGCCAACCCAAGTGCAAGGAAGG - Intronic
1058726240 9:107807287-107807309 CCCCAACCTAACTGCAAAGAAGG - Intergenic
1187019273 X:15363139-15363161 CCGCAAACCTAGTGGACCGATGG + Exonic
1188717394 X:33476815-33476837 CCCCAGCCCAAGGGCAGCAAGGG - Intergenic
1190933893 X:54976336-54976358 CACCAACCCAAATGTACAGATGG + Intronic
1191627418 X:63283806-63283828 CCCCAGCCCAAGGGCAGCAAGGG - Intergenic
1192756326 X:74049868-74049890 CCCCAATCCAAGGGCAGCAAGGG - Intergenic
1196188618 X:112771691-112771713 CACTATCCCAAGTGCACTGATGG - Intergenic
1200360795 X:155604256-155604278 CCCCAATCCAAGGGCAGCAAAGG - Intronic