ID: 1071293470

View in Genome Browser
Species Human (GRCh38)
Location 10:84203223-84203245
Sequence CTCTGTGTGAGGAGGGCAAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 231}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071293470_1071293479 16 Left 1071293470 10:84203223-84203245 CCGGTTGCCCTCCTCACACAGAG 0: 1
1: 0
2: 1
3: 19
4: 231
Right 1071293479 10:84203262-84203284 CCCAGCCTCAGGCCATGAACTGG 0: 1
1: 0
2: 3
3: 39
4: 313
1071293470_1071293477 5 Left 1071293470 10:84203223-84203245 CCGGTTGCCCTCCTCACACAGAG 0: 1
1: 0
2: 1
3: 19
4: 231
Right 1071293477 10:84203251-84203273 CTCTGGACTCACCCAGCCTCAGG 0: 1
1: 0
2: 4
3: 65
4: 434

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071293470 Original CRISPR CTCTGTGTGAGGAGGGCAAC CGG (reversed) Intronic
900008952 1:88735-88757 CTCTGGGTGCTGAGGGCAAGAGG - Intergenic
901161201 1:7177687-7177709 CTGTGTGTGGGGAGGGGTACTGG - Intronic
902705261 1:18199933-18199955 CATTGTGTGAGCAGGGTAACAGG + Intronic
904461377 1:30682477-30682499 CTTTGTGTGAGGACAGCAATGGG - Intergenic
906886151 1:49650996-49651018 CTCTGTGTACGGAGGGCAGATGG - Intronic
907277551 1:53325750-53325772 GTCTGAGGGAGGAGGGCGACAGG - Intronic
907830482 1:58060110-58060132 TTCTGTGTGGGGAGAGCAGCAGG + Intronic
908025426 1:59946251-59946273 CTCTGAGTCAGGAGGGTACCTGG - Intergenic
908678770 1:66635383-66635405 GTCTATGTGTGGAGGGAAACTGG - Intronic
909596710 1:77413864-77413886 CTCTGGGTGAGAAGGGGAAGTGG - Intronic
909686156 1:78351220-78351242 GTCTTTGTGAGGAAGGCAATTGG + Intronic
909933647 1:81527243-81527265 CACTTTGTGATGAGGGAAACTGG - Intronic
910429021 1:87143031-87143053 CGCTGTGTGAGGAGGGCGGCAGG - Intronic
911094148 1:94042190-94042212 CGCTGTGTGAGTAGAGCAAGGGG + Intronic
912709638 1:111941272-111941294 CTCTTTGTGAGGAGGTAATCTGG + Intronic
913072623 1:115314345-115314367 CTTTGTGTGATGAGGAAAACAGG - Intronic
917272169 1:173289077-173289099 CTCTGTGAGTTGAGGGGAACAGG + Intergenic
918105810 1:181414085-181414107 CTCTGTTTGTGTAGGGCAAAAGG + Intronic
918412793 1:184277673-184277695 CTCTGTGTGTGGAAGGGGACAGG + Intergenic
919086739 1:192929520-192929542 ATCTGAGTAAGGAGGGAAACGGG + Intergenic
921389656 1:214605758-214605780 CGCTGTGGGTGGAGGGCACCAGG - Intronic
922738184 1:228000965-228000987 CCCTGTGGGACGAGGGCAAGGGG - Intergenic
922791109 1:228311603-228311625 CTCTTTGTGAGGAGGCTCACAGG + Intronic
923143151 1:231178621-231178643 TTCAGTGTGAGGAGGGGAAGTGG - Intronic
1063737677 10:8779069-8779091 CTCTGTGTGTGAAGGGCCATGGG - Intergenic
1065040443 10:21688843-21688865 CTCAGTGTGAGAAGGGACACAGG - Intronic
1065610882 10:27469710-27469732 GTCGGTGTCAGGAGGGGAACGGG - Intergenic
1067277167 10:44846082-44846104 CTTAGTTTGAGGAGGGCATCTGG - Intergenic
1067663174 10:48251615-48251637 CTCTGTCTGAGGAGGAAATCTGG - Exonic
1071057599 10:81529458-81529480 CTCTCTGGAAGCAGGGCAACTGG - Intergenic
1071293470 10:84203223-84203245 CTCTGTGTGAGGAGGGCAACCGG - Intronic
1071569708 10:86690289-86690311 GTCTGGGTGAGATGGGCAACAGG - Intronic
1071573226 10:86709328-86709350 CCCAGTTGGAGGAGGGCAACAGG + Intronic
1072420738 10:95289426-95289448 CTCTGTGGGACGAGGCAAACAGG + Intronic
1073112754 10:101072320-101072342 CTCTTTGGGAGGAGGGAAATAGG + Intergenic
1073267883 10:102239376-102239398 CTCTGTGTCAGGAAAGGAACAGG - Intronic
1073585332 10:104704525-104704547 TCCTGGGTGAGGAGGGAAACTGG + Intronic
1074707452 10:116147617-116147639 CTCTGTGTGAGGATGGCAGGTGG - Intronic
1075300114 10:121314675-121314697 CTCTGTCTTAGGAAGCCAACGGG + Intergenic
1075777704 10:124998973-124998995 CTCTGGCTGAGGAGGGTAAATGG - Intronic
1075955537 10:126520075-126520097 CTGTTTCTGATGAGGGCAACAGG - Intronic
1076006208 10:126949583-126949605 CTCTCTGTGATGAGAGCATCGGG + Intronic
1076447335 10:130525643-130525665 CTCTTTGTGGGGAGGGTAACAGG + Intergenic
1076474712 10:130744019-130744041 CTCTGCCAGAGGAGGGCATCTGG - Intergenic
1076586583 10:131552655-131552677 CTCTGAGTGAAGAGGTCAAGAGG - Intergenic
1078963781 11:16312634-16312656 CTGTGACTGAGGAGGTCAACAGG - Intronic
1080573628 11:33578829-33578851 CCCAATGTGAGGAGGGCAATGGG - Intronic
1083712680 11:64558880-64558902 CTCTGCATGAGGGGGGCCACTGG + Intronic
1083717217 11:64584321-64584343 CTCTGTGTTGGGAGGACAAGAGG - Intergenic
1083846020 11:65334039-65334061 CTCCTGGTGGGGAGGGCAACAGG + Intronic
1083853781 11:65382228-65382250 CTCGCTCTGAGGATGGCAACTGG + Intronic
1084594405 11:70108471-70108493 CTCTGTGGGAGGCAGGCAGCCGG + Intronic
1085839678 11:79997063-79997085 CTGTGTGGGAGGATGGCAATTGG - Intergenic
1086436998 11:86791361-86791383 ATCTGTGTGCGGAGGGCAGAAGG + Intronic
1087675650 11:101158387-101158409 CTCTGTGTGGGGAGCCCCACTGG - Intergenic
1088351343 11:108891832-108891854 CACTTTGTGGGGAGGGCACCGGG + Intronic
1088361240 11:108992220-108992242 ATCTGTCTGAGGAGGGCACTGGG + Intergenic
1090347574 11:126083506-126083528 CTCTGTTAGAGTAGAGCAACTGG + Intergenic
1091057389 11:132431517-132431539 CTCTGTGTGGGGAAGGCAACCGG + Intronic
1092170365 12:6370485-6370507 TTCTGTGAGAGGAGGCCACCGGG - Intronic
1092973479 12:13721374-13721396 TGTTGTGTGGGGAGGGCAACTGG + Intronic
1094582879 12:31750592-31750614 CTTTCTGTGAGGGGAGCAACAGG - Intergenic
1097931247 12:65189369-65189391 CTCTGTGTCCGGAGGGCAGTTGG + Intronic
1099528984 12:83752426-83752448 CTTTCTGTGAAAAGGGCAACTGG + Intergenic
1101265125 12:103076368-103076390 CTCTGTATGATGAGGGCAAGAGG + Intergenic
1104655160 12:130568925-130568947 GGCTGTGTGAGGAGGGCACGTGG - Intronic
1104714149 12:131005536-131005558 CTCTGCGTGTGGAGGGCAGACGG + Intronic
1105213656 13:18272365-18272387 CTGTGTGTGGGGAGGGCACAGGG - Intergenic
1106183504 13:27387974-27387996 TTCTGTGTGAGGAGGGCTCAGGG - Intergenic
1108459486 13:50650959-50650981 CTCCCTGTGAGGAGGGCAGCAGG + Intronic
1110080255 13:71300431-71300453 GTCTGGGTGTGGAGGGCAACTGG + Intergenic
1111991828 13:95124311-95124333 CTCTCAGTGAGGAAGGCACCGGG - Intronic
1116118985 14:40696846-40696868 CTTTGTGTGAGAAGGGTAAGAGG - Intergenic
1116987852 14:51240266-51240288 CTCCCTGTGAGGTGGGCAAGCGG + Exonic
1117166252 14:53036922-53036944 CTGTGGGTGAGGAGGGCAGAAGG - Intronic
1120166306 14:81205082-81205104 CTCTCTGTGAGTATGGCAAAGGG - Intronic
1121389286 14:93560611-93560633 CTCAGTGTCATGAGGGGAACAGG + Intronic
1122767391 14:104081768-104081790 CTGTGTGGAAGGAGGGCCACTGG + Intergenic
1125766770 15:42141575-42141597 CTCAGTGTAAGGAGGACAGCTGG + Exonic
1128639279 15:69324209-69324231 CCCTGTGTGAGGATGGCAGGGGG - Intronic
1129373164 15:75110451-75110473 CTCTGTGTCAGGTGGGAAGCCGG - Intronic
1132343510 15:101092753-101092775 CTCAGTGAGAGGAGGGAGACAGG + Intergenic
1132464596 16:71863-71885 CTCTGTGCGCAGAGGCCAACGGG - Intronic
1132595398 16:746816-746838 CTGTGTGTGATGGGGGCATCTGG - Intronic
1132944200 16:2523618-2523640 CTCTGTGTGGGGAGGGCTGTGGG - Intronic
1132973450 16:2700199-2700221 CTCTGTGTGAGGGAGGGGACTGG + Intronic
1137758360 16:50920279-50920301 GGCTGTGTGAAGAGGGCAGCTGG + Intergenic
1141583967 16:85020655-85020677 GTCAGTGTGTGGAGGGCAAGGGG + Intergenic
1141970006 16:87474817-87474839 CTCTGTGTGAGCCCTGCAACAGG + Intronic
1142455384 16:90218229-90218251 CTCTGGGTGCTGAGGGCAAGAGG + Intergenic
1142809577 17:2389046-2389068 CTGTGTGTGATGAGGGCAGACGG - Intronic
1143575782 17:7792357-7792379 CTGGGTGTGAGGAGGGCATGGGG + Intronic
1144783659 17:17820170-17820192 CTCTGTGGCAGGAGGGCCCCTGG + Exonic
1148848214 17:50541328-50541350 CTGTGGGTGAGCAGGGCAAGGGG + Exonic
1148863770 17:50618201-50618223 CTCTGGGGGAGGAGGGAAAGGGG - Exonic
1150234102 17:63578614-63578636 CTCCGTGTGTGGAGGGTAAGCGG + Exonic
1152248834 17:79200906-79200928 CTCTGTGTGCGGCGGGCAGCTGG + Intronic
1152264568 17:79286852-79286874 CAGTGTCTGAGGAGGGCACCAGG - Intronic
1152641393 17:81450753-81450775 TTCCTTGTGAGGAGGGCAGCGGG - Intronic
1152988894 18:344340-344362 CTCTGTCTGAGGAATGCCACTGG - Intronic
1153027670 18:686437-686459 CTCAGTGAGAGGAAGGCCACAGG + Intronic
1153739712 18:8111123-8111145 CTCTGTGTGTGTTGGGCACCTGG + Intronic
1154348762 18:13565755-13565777 CTTTGTGTGTGGAGGGGAATTGG + Intronic
1158535984 18:58308857-58308879 CACTGGGTGATGAGGGCATCAGG - Intronic
1159370109 18:67517649-67517671 CTCCATGTGTGGAGTGCAACAGG - Intergenic
1159928949 18:74292784-74292806 CTCTGTGTCAGAAGGGAAAGAGG - Intergenic
1160620017 18:80164122-80164144 CTCTGTGTGTGGGGTGCAGCAGG - Intronic
1163283598 19:16332284-16332306 ACCTGTGTGTGGAGGGAAACAGG - Intergenic
1163536872 19:17881939-17881961 TGCTGTGTGAGGAAGGCAGCGGG - Exonic
1163820558 19:19494230-19494252 CTCCGTGTGAGGAGAGGGACCGG + Intronic
1165702459 19:37948954-37948976 CACTGTGGCAGGAGGGCAGCGGG + Intronic
1165984491 19:39756100-39756122 CTCTGAGTGAGGAGGTCACCCGG + Intergenic
1166351932 19:42203190-42203212 TTCTGTGTGAGGTAGCCAACAGG - Intronic
1168543564 19:57231904-57231926 GTCTGTGTGAGAAGGGAAAGCGG + Intronic
1168717896 19:58539802-58539824 CCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168717908 19:58539842-58539864 CTCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718045 19:58540422-58540444 CCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718288 19:58541390-58541412 CCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718397 19:58541853-58541875 CCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718489 19:58542240-58542262 CCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718539 19:58542436-58542458 CCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718619 19:58542784-58542806 CCCTGTCTGAGGAGGGAAGCAGG - Intergenic
925111388 2:1341400-1341422 CTTTCTGTGAGGAGGGCATTCGG - Intronic
925293828 2:2765278-2765300 CCCTGTGTGTGGAGGGGCACGGG - Intergenic
926698212 2:15785238-15785260 CCCTGTGTGCCGAGGGCAGCGGG + Intergenic
927050257 2:19321234-19321256 CTCTGCTTGAGGAGGGCACCGGG + Intergenic
929329526 2:40664007-40664029 CTATGTTTCAGCAGGGCAACAGG + Intergenic
929920378 2:46167395-46167417 CTGTTGGTGAGGAGGACAACAGG + Intronic
929938952 2:46315773-46315795 CTCTGAGGGTGGAGGGCAAGAGG + Intronic
930019760 2:46994394-46994416 CCCTGAGTGAGGAGTGCTACTGG + Exonic
930849256 2:55940428-55940450 CTCAGTGTGAGGAGGGCTTGTGG + Intergenic
934300672 2:91774381-91774403 CTGTGTGTGGGGAGGGCACAGGG + Intergenic
934654537 2:96110312-96110334 CCCTGTGTGTGGGGGGCCACTGG - Intergenic
935693889 2:105754004-105754026 TTTTGTGTTAGGAGGGCCACTGG + Intronic
938187091 2:129241109-129241131 TTCGGTGTGAGGAGGGCATGAGG - Intergenic
939541386 2:143498348-143498370 CTCTGTGGGAGGGAGGCAAGAGG + Intronic
940525406 2:154807831-154807853 TTCTTTGTGAGGAAGGCACCAGG + Intronic
945063342 2:205927205-205927227 AGATGTGTGAGGAAGGCAACAGG - Intergenic
946044428 2:216809932-216809954 CTCTGTGTGACGGGGGCACAGGG - Intergenic
947147681 2:227083398-227083420 ATCTGTGTGAGCAAAGCAACTGG - Intronic
947526462 2:230879459-230879481 TTCCGGGTGAGGAGGGGAACAGG + Intergenic
948942860 2:241204722-241204744 CCCTATGTGAGGAGGCCAAGAGG - Intronic
949086883 2:242163026-242163048 CTCTGGGTGCTGAGGGCAAGAGG + Intergenic
1168958570 20:1852158-1852180 CCCTGTGTGAGAGGGGCACCAGG + Intergenic
1169680909 20:8212775-8212797 CTCTGCATGTGGAGTGCAACTGG - Intronic
1172305599 20:33878077-33878099 CTCTATTTGAGGTGGGGAACTGG + Intergenic
1172535403 20:35669311-35669333 CTCTTGGTGAGGAGAGCAAGAGG - Exonic
1173644600 20:44625683-44625705 CTCTGTGTGAGGAGAGGAGTAGG + Exonic
1173766240 20:45612274-45612296 CTCTGTGTGTGGAGGGAGACAGG + Intronic
1173863209 20:46297566-46297588 CTCTGTGGGAGGTGGGGATCTGG + Intronic
1174420979 20:50399092-50399114 CTCTGTGTGATGTGGGCTAATGG + Intergenic
1176304432 21:5115806-5115828 CTCAGTGGGAGGAAGGCCACTGG + Intergenic
1179802496 21:43817481-43817503 CTATGTGGGAGGAGGGCGCCAGG - Intergenic
1179852626 21:44146224-44146246 CTCCGTGGGAGGAAGGCCACTGG - Intergenic
1180816487 22:18792756-18792778 CTGTGTGTGGGGAGGGCACGGGG - Intergenic
1181202674 22:21227088-21227110 CTGTGTGTGGGGAGGGCACGGGG - Intronic
1181699027 22:24609517-24609539 CTGTGTGTGGGGAGGGCACAGGG + Intronic
1182623452 22:31630268-31630290 CTCTGGGTGCTGAGGGGAACCGG + Intronic
1183366863 22:37411448-37411470 CCCTGGGTGAGGAGGGGAAGCGG + Intronic
1183591173 22:38780124-38780146 CCCTGTGTGAGGAGGTCTAGAGG + Intronic
1184102029 22:42345729-42345751 CCCTCAGTGAGGAGGGCAACTGG - Intergenic
1184206583 22:43007867-43007889 ATCTGTGGGTGGAAGGCAACAGG - Intronic
1185019257 22:48364256-48364278 CTATGTGCCGGGAGGGCAACCGG + Intergenic
1185095410 22:48803625-48803647 GGCTGTTTGAGGAGGGCAGCTGG + Intronic
1203224239 22_KI270731v1_random:68325-68347 CTGTGTGTGGGGAGGGCACGGGG + Intergenic
1203266587 22_KI270734v1_random:18467-18489 CTGTGTGTGGGGAGGGCACGGGG - Intergenic
950470052 3:13179195-13179217 CTCTCTGTGAGGTGAGCAGCAGG + Intergenic
953421182 3:42754435-42754457 TTGTGTGTCAGGAGGGTAACGGG + Intronic
954761161 3:52875450-52875472 CACTGTGTGAGGGGGCCAGCAGG - Intronic
959681722 3:109104221-109104243 CTCTCTGTGGGGAGGGAAAAAGG + Intronic
961445954 3:126981917-126981939 CTCTGTGTGGTGAGGGCACAGGG - Intergenic
962200609 3:133398599-133398621 CTCTCTGGGTGGTGGGCAACAGG + Intergenic
962498787 3:135967934-135967956 CTGTGTGTGTGGAGTGCTACTGG - Intronic
963908179 3:150791503-150791525 CTCTGTGTGTGGAGGGCACATGG - Intergenic
968737309 4:2304123-2304145 CTGTGTGTGAGGAGGGGCAGGGG - Intronic
969300641 4:6294975-6294997 CTCTGTGTGAGGGTGGCAGTGGG + Intronic
969584661 4:8084827-8084849 CACTGTGTGCCGAGGGCAAGAGG - Intronic
971161448 4:24137867-24137889 CTGTGTTTGAGGGGGGAAACGGG - Intergenic
974194184 4:58550210-58550232 CTGTGTGTGAGTAGGGCATGAGG + Intergenic
975339488 4:73223091-73223113 CTCTGTGTCAGCAAGGGAACAGG + Intronic
981466091 4:145074306-145074328 CTCTTTTTGAGGAGGGCAGAGGG + Intronic
982295965 4:153829464-153829486 CTCTCTGTGAACAGGGTAACTGG + Intergenic
984933278 4:184867255-184867277 CCTTATGAGAGGAGGGCAACAGG + Intergenic
985525513 5:399487-399509 CTCTGTGACTGGAGGGCAAATGG - Intronic
987275923 5:16362420-16362442 CTTTCTGTGAGGTGAGCAACAGG - Intergenic
988390715 5:30625701-30625723 CTTTCTGTGAGGAGAGCAGCAGG - Intergenic
988731950 5:33981187-33981209 CTCTGTGTAAGGAAGGCAGAGGG - Intronic
988908487 5:35815230-35815252 CTCTGAGTTAGGAGGGCCCCAGG + Intergenic
990630329 5:57661812-57661834 CTCTGAGTCAGGAAGGCAAAGGG + Intergenic
991408255 5:66322423-66322445 TCCTGTGTGAGGAGGGGCACAGG - Intergenic
991446062 5:66701396-66701418 CTCTCTGTGAGGAGAGACACGGG - Intronic
994544276 5:101143387-101143409 CTCTGTGTGTGGAAGATAACAGG + Intergenic
996411245 5:123161769-123161791 CTCTGTGTGAGCTAGGCAAAGGG + Intronic
996738114 5:126776028-126776050 CTCCGTGTGATGTGGGAAACTGG - Intergenic
997527147 5:134560727-134560749 CTCTCTGTGAGGAGGACAGCAGG - Exonic
997597139 5:135114629-135114651 CTGTGTGTGGGGGGGGGAACAGG - Intronic
998729923 5:145062923-145062945 CTGTGTGTGGGGAGGGCAGTGGG + Intergenic
999302499 5:150499910-150499932 CTCTGTGTGCTGAGGCCAGCAGG + Intronic
1000393525 5:160749425-160749447 CACAGTATGAGGAGGGCAGCTGG - Intronic
1002793679 6:453230-453252 CTCTGTGTGCAAAGGGCAGCTGG - Intergenic
1003761429 6:9182732-9182754 ATATGTGTGAGGAGGGCAGGGGG + Intergenic
1006420497 6:33930986-33931008 GCCGGTGTGAGGAGGGCAGCAGG + Intergenic
1009524670 6:64728880-64728902 CTCTCTGTGGGGAGGGGAGCTGG + Intronic
1011625408 6:89279267-89279289 GTCTGTGTGAGGCAGGCAGCGGG + Intronic
1013639997 6:112064838-112064860 CTCTGTGTGAGTGGGGCCATTGG + Exonic
1018644993 6:165940033-165940055 ATCTGTGTGATGGGGGCAATGGG + Intronic
1018702046 6:166434947-166434969 CTTCCTGTGAGGAGGGGAACAGG + Intronic
1018848796 6:167573104-167573126 CTCTGTGTAGGGAGAGGAACGGG - Intergenic
1022178291 7:27893629-27893651 TTCTGTGATAGGAGGGCATCCGG - Intronic
1022328084 7:29351505-29351527 CTCTCTGTGAGGAGAGTGACTGG + Intronic
1023102799 7:36736225-36736247 CTCTGTATCTGGAGGGCAAGGGG - Intergenic
1024763593 7:52629741-52629763 CTCAGTGTGAGGAGGCCTCCTGG - Intergenic
1025249848 7:57344368-57344390 CTCTGTGTGATGTGGGCTAACGG - Intergenic
1027224741 7:76236723-76236745 CTCTGGGTGAGGTGAGCATCAGG - Intronic
1027232233 7:76279551-76279573 CTCTGTGTAGGGAGGGAGACAGG + Intronic
1028916772 7:96268061-96268083 CTGTCTGTGAGGTGGGCACCGGG - Intronic
1030914285 7:115293531-115293553 CTCTGTATAAGGAGGGTAAGTGG + Intergenic
1032440015 7:131935404-131935426 CTCTGTGTGGGCAGGGCATGAGG + Intergenic
1033492348 7:141855716-141855738 CTCTGTGTGGGGAAGGCATACGG - Intergenic
1034256491 7:149727507-149727529 CTCTGTGTGAGGAGGAGGAGGGG - Intronic
1034868292 7:154659206-154659228 CCCTGTGTCAGGTGGGAAACTGG - Intronic
1035497843 8:68314-68336 CTCTGGGTGCTGAGGGCAAGAGG - Intergenic
1037896253 8:22658285-22658307 CTGTGTGTACGGAGGGCAAAGGG + Intronic
1038644866 8:29352684-29352706 CTCCCTGTGGGGAGGGCAAAAGG + Intergenic
1039968409 8:42300294-42300316 CACTGAGTGAGAAAGGCAACAGG - Intronic
1041366655 8:57113587-57113609 TTCTTTGTGATGAGCGCAACAGG - Intergenic
1042935776 8:74056686-74056708 TTGTGTGTGAGGAGGAGAACTGG + Intergenic
1043091750 8:75913119-75913141 CTCTGTATCAGGAAGGCCACTGG - Intergenic
1044517401 8:93155236-93155258 CTTGGTGTGAGTAGGGCAAATGG + Intronic
1049299560 8:141862399-141862421 CTCTGTTTGGGGAGGGGAAGCGG - Intergenic
1049314104 8:141950563-141950585 CACTGAGTGAGGAAGGCATCTGG + Intergenic
1053423769 9:37997844-37997866 CACTGTGTGACAAGGGCAAGTGG + Intronic
1053428246 9:38025209-38025231 CTCTGTGGGAGGTGGGCTCCGGG + Intronic
1054204303 9:62116849-62116871 ATCTGTGAGAGAAGGGCAAAGGG + Intergenic
1056106458 9:83351866-83351888 ATTTGTGTGAGGATGGCAAAAGG - Intronic
1057303439 9:93899474-93899496 CTCTGTATGAGGAGGGGAGCTGG - Intergenic
1058160741 9:101568062-101568084 ATGTGTGTGAAGAAGGCAACAGG + Intergenic
1058547473 9:106076247-106076269 CTCTGTGTAAGGAAAGCCACAGG - Intergenic
1060101778 9:120847057-120847079 CTCTGGGTGAGGAGAGAAGCAGG - Intergenic
1061929430 9:133824825-133824847 CTCTGAGAGAGGAAGGCACCTGG - Intronic
1062444184 9:136586830-136586852 CTCTGTGTGTGCAGGGCAAGAGG + Intergenic
1062623512 9:137433136-137433158 CCCTGTGGGTGGAGGGCAGCCGG - Intronic
1203376634 Un_KI270442v1:382535-382557 CTCTGGGTGTGTGGGGCAACAGG + Intergenic
1186416908 X:9391777-9391799 GGCTGTGGGTGGAGGGCAACGGG + Intergenic
1188434308 X:30142952-30142974 CTCAGTGTGAGGATGGGAACTGG + Intergenic
1193096789 X:77557919-77557941 CTCTGTAGGAGGAGGACAGCAGG + Intronic
1193981601 X:88187617-88187639 CTCTGCGTGAGGAGAGGAAATGG + Intergenic
1196186177 X:112747409-112747431 CTCACTGTGAGGAGGGCGACTGG - Intergenic
1196713978 X:118793605-118793627 CTGTGTGTGAGGAGAGAAATGGG - Exonic
1197706067 X:129635351-129635373 CTCTGTGTGTCGAGGGGTACAGG + Intergenic
1197861849 X:130979551-130979573 CTCTGGGTGAGGTGGGCAAAAGG - Intergenic
1201695008 Y:16815205-16815227 CTTTGTGTGAGGAAGGTAAGAGG + Intergenic