ID: 1071298168

View in Genome Browser
Species Human (GRCh38)
Location 10:84237545-84237567
Sequence CAGCTGCTCCAGGCGGCCCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 404
Summary {0: 1, 1: 0, 2: 2, 3: 48, 4: 353}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071298158_1071298168 27 Left 1071298158 10:84237495-84237517 CCCCGCAGCATGAGGGCGTTGAG 0: 1
1: 0
2: 0
3: 5
4: 54
Right 1071298168 10:84237545-84237567 CAGCTGCTCCAGGCGGCCCAGGG 0: 1
1: 0
2: 2
3: 48
4: 353
1071298159_1071298168 26 Left 1071298159 10:84237496-84237518 CCCGCAGCATGAGGGCGTTGAGC 0: 1
1: 0
2: 1
3: 7
4: 74
Right 1071298168 10:84237545-84237567 CAGCTGCTCCAGGCGGCCCAGGG 0: 1
1: 0
2: 2
3: 48
4: 353
1071298160_1071298168 25 Left 1071298160 10:84237497-84237519 CCGCAGCATGAGGGCGTTGAGCT 0: 1
1: 0
2: 0
3: 3
4: 69
Right 1071298168 10:84237545-84237567 CAGCTGCTCCAGGCGGCCCAGGG 0: 1
1: 0
2: 2
3: 48
4: 353

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071298168 Original CRISPR CAGCTGCTCCAGGCGGCCCA GGG Exonic
900156826 1:1206515-1206537 CAGCAGCGCCAGGCCGCACAGGG + Exonic
900539804 1:3197051-3197073 CAGCTGCACGAGGCGGCCCGAGG + Intronic
900919742 1:5662693-5662715 CTGCTGCTGCTGGAGGCCCAGGG - Intergenic
900989605 1:6092290-6092312 CAGATCCTCCAGGGAGCCCAGGG + Intronic
901869095 1:12127016-12127038 CAGCTCTTCCAGGCAGCCCTTGG + Intronic
902606279 1:17571125-17571147 CAGGTGACCCAGGTGGCCCAGGG + Intronic
902609435 1:17588458-17588480 CAGCTGCTCCACCCGGCACAGGG + Exonic
902721963 1:18309778-18309800 CAGCAGCTCCAGCCCTCCCAGGG - Intronic
903442760 1:23400871-23400893 CAGCTGCGCCAGGCAGCCTTGGG + Intronic
903450750 1:23452216-23452238 AATCTGCCCCAGACGGCCCAGGG - Intronic
903597060 1:24502952-24502974 CTGCTGCTGCAGGCGGCTCCCGG + Exonic
903853137 1:26320324-26320346 CAGCTGTTTCAGGGGGCACAGGG - Exonic
903918281 1:26780317-26780339 CAACTTCTCCAGGCGGCTGAAGG - Exonic
904083553 1:27887499-27887521 CAGCGAGTCCAGGCAGCCCAGGG - Intergenic
904591640 1:31618304-31618326 CAGCGGCTCCTGGCGGCCGTCGG + Intronic
905168806 1:36098411-36098433 CAGTTGGTCCAGGGGGTCCATGG + Exonic
905169170 1:36099338-36099360 CAGCAGGGCCAGGCTGCCCATGG + Exonic
905211083 1:36374554-36374576 CAGCTGCTTCCGGAGGCCCTTGG - Intronic
906041824 1:42793581-42793603 CTCCTGCCCCAGACGGCCCAAGG - Intronic
906057936 1:42930656-42930678 CAGCTGGTGCAGGGTGCCCAGGG + Exonic
906279139 1:44541696-44541718 CTGCTTCTCAAGGCAGCCCAGGG + Intronic
907121495 1:52012026-52012048 CACCTACTCCAGGCCGGCCACGG + Intergenic
907462709 1:54614795-54614817 CAGCTGCCGCAGGAGGTCCAGGG + Exonic
907470925 1:54673021-54673043 CACCAGCCCCAGGCGGCCCCTGG - Intronic
908492894 1:64664022-64664044 CAGATTCTCCATGTGGCCCACGG - Intronic
912800800 1:112718843-112718865 CAGCGGCCCCTGGCGGCCGAGGG - Intergenic
915544167 1:156586466-156586488 CAGGTCATCCAGGTGGCCCAGGG + Exonic
915770804 1:158420789-158420811 CAGCTGCTGCAGCCTGGCCAGGG + Exonic
915774258 1:158465617-158465639 CAGCTGCTGCAGCCTGGCCAGGG - Exonic
917819679 1:178749700-178749722 CAGCTGCTCCAGAAGGCTGATGG + Intronic
918046614 1:180945371-180945393 CACCTCCACCAGGCGGCCCACGG - Exonic
919841754 1:201614377-201614399 CAGCTGCTGCGGGCGCCTCAAGG + Intergenic
919880211 1:201896028-201896050 CAGCTGCTCCAGGGGTGCCCTGG - Intergenic
920649086 1:207823458-207823480 CAGCTGCTCAAGCCTGACCAGGG - Intergenic
922586081 1:226736210-226736232 GAGCTGGTCCAGGCTGCCCAGGG - Exonic
923147088 1:231205809-231205831 CAGCAGCTCCAGGAGGGCTAAGG + Intronic
923370059 1:233300910-233300932 CAGCTGTTCATGGGGGCCCATGG - Intergenic
1064227509 10:13500517-13500539 CAGCTTCACCAGGCGGGGCAAGG + Exonic
1065486307 10:26239354-26239376 CACCTGCTCCAGAAGGCCTAAGG - Intronic
1067428673 10:46227922-46227944 CAGCTGCACCAGGCAGATCAGGG - Intergenic
1070307752 10:75249722-75249744 TAGCTGCTGCAGCCAGCCCAAGG - Intergenic
1070724375 10:78778280-78778302 CAGCTCACCCAGGGGGCCCAGGG + Intergenic
1071298168 10:84237545-84237567 CAGCTGCTCCAGGCGGCCCAGGG + Exonic
1071574356 10:86715053-86715075 AGGCTGCCCCAGGCGGTCCAGGG + Intronic
1072002831 10:91214383-91214405 CTGCTGCTCCAGCAGTCCCATGG - Intronic
1072732835 10:97859293-97859315 CAGGTGCTCCAAGAGGCCAAGGG - Intronic
1073057503 10:100711658-100711680 CAGCTTCTCCAGGCTCCCCTCGG + Intergenic
1073116493 10:101094525-101094547 CAGCTGATCCAGGAAGCCCGGGG - Intronic
1073196233 10:101694479-101694501 CACCTGGGCCAGGCGGCCGAGGG + Exonic
1074431408 10:113398022-113398044 AAGCTGCTCCAGGACTCCCAGGG + Intergenic
1075704799 10:124494296-124494318 TAGCTCCTCCAGCCGGCCCCAGG + Intronic
1075781261 10:125018698-125018720 CACCTACCCCAGGTGGCCCATGG - Intronic
1076132827 10:128025757-128025779 GACCTGCTCCAGGGGACCCAGGG + Intronic
1076133525 10:128029420-128029442 CACCTGCTTCAGACGCCCCATGG - Intronic
1076549421 10:131268104-131268126 CAGCTGCTCAAGGCCGGCTATGG - Intronic
1076686476 10:132200518-132200540 CAGCCTCTCCAGGTGGCCCCAGG + Intronic
1076813065 10:132899156-132899178 CAGCAGCTCCAGGTGGGCCCAGG - Intronic
1076991778 11:279479-279501 CAGCTGCTCCGCGAGGTCCACGG - Exonic
1077036943 11:499831-499853 CAGCTTTTCCAGGCGGCACTGGG + Exonic
1077210747 11:1370008-1370030 CAGCTCCTCCATGGGGCTCATGG - Intergenic
1077321021 11:1942042-1942064 CACCTGCTCCTGGTGGCCCAGGG - Intergenic
1077324065 11:1956105-1956127 ACGCTGCCCCAGGAGGCCCAGGG + Intronic
1077423321 11:2463009-2463031 CAGCGGCGGCAGGGGGCCCAGGG + Intronic
1077495909 11:2886307-2886329 CAGCTGGCGCAGGAGGCCCACGG - Intergenic
1077674970 11:4187485-4187507 CAGCTGCGGCAGCCGGGCCATGG - Intergenic
1077997551 11:7466982-7467004 CACCTTCTGCAGGTGGCCCAAGG + Exonic
1078349639 11:10581914-10581936 AAGCTCCTCCAGGCAGCTCAGGG + Exonic
1079109259 11:17595130-17595152 CAACTGCTCCAGGTGGGGCAGGG + Intronic
1079321248 11:19453555-19453577 AGGCTGATCCAGGCAGCCCATGG - Intronic
1081585672 11:44382126-44382148 AGGCTGGTCAAGGCGGCCCAGGG - Intergenic
1081922341 11:46790533-46790555 CAGCTGCACCAGGAGGCGCAGGG - Exonic
1083169440 11:60914322-60914344 CAGCCGCTGCAGGCGGCACCAGG + Intronic
1083289100 11:61680161-61680183 CAGCCCCTCCCGGCCGCCCACGG + Intergenic
1083325559 11:61871283-61871305 CAGATGCTCCGGGCGCCCCTGGG + Intergenic
1083431246 11:62614562-62614584 CAGCGGTTCCAAGAGGCCCAGGG - Intronic
1083878729 11:65538000-65538022 CAGCTGCTCCAGTCGGACTCTGG - Exonic
1083885518 11:65571703-65571725 TAGCTGCTGCAGGCTGCGCAGGG - Exonic
1084412125 11:69011253-69011275 CACCAGCTCCGGGAGGCCCAGGG - Intronic
1084438968 11:69159920-69159942 CAGCTGTTCCGGGTTGCCCAGGG + Intergenic
1084469480 11:69348695-69348717 CAGCTGCCCATGGCTGCCCATGG - Intronic
1085394645 11:76201162-76201184 CAGACTCCCCAGGCGGCCCAAGG + Intronic
1086054118 11:82627589-82627611 GCGCTGCTGCAGGCGGTCCAGGG - Intergenic
1088691569 11:112333018-112333040 CTGCTCCCCCAGGCTGCCCAGGG + Intergenic
1089499666 11:118924941-118924963 TCGCTGCTCCAGCTGGCCCAAGG + Intronic
1089505278 11:118958253-118958275 CAGCTTCTCCAGGAAGCCCAGGG + Exonic
1089754291 11:120674956-120674978 CAGCAGCTCCAGGAGGTGCAAGG - Intronic
1090187009 11:124745658-124745680 CAGCTCCGCCAGGCCCCCCAGGG - Exonic
1090382618 11:126337695-126337717 CAGCGGCTCCAGGCGGGCAGAGG + Intronic
1091294837 11:134466429-134466451 CAGCTCCTGCAGTCGGCCCTTGG + Intergenic
1202807051 11_KI270721v1_random:11300-11322 ACGCTGCCCCAGGAGGCCCAGGG + Intergenic
1091851000 12:3696883-3696905 CTTCTGCTCCAGGCTGTCCAGGG + Exonic
1094835935 12:34322112-34322134 CAGCTGCTGCATGGGGCCCTGGG - Intergenic
1095844807 12:46733007-46733029 CTGTTGCTTCAGGCAGCCCAGGG + Intergenic
1095943428 12:47740512-47740534 CAGAGGCTCCAGGGGACCCAGGG + Intronic
1096264156 12:50110530-50110552 CAGCTGCTCCAGACCGGCCAGGG + Exonic
1096531389 12:52244756-52244778 CAGCTGCTCCAGGCAGGCACAGG + Intronic
1103045708 12:117732939-117732961 CATCTGCTCCTGGCGGCTGATGG - Intronic
1103907516 12:124335181-124335203 CCGCTGCTCCAGACCGCCCCAGG - Exonic
1104155355 12:126126110-126126132 CTGCTGGACCAGGCGGCACAGGG + Intergenic
1104262438 12:127196902-127196924 CAGCTGCTCCAGCCAGCCAAAGG + Intergenic
1104418418 12:128614979-128615001 CAGCTGCCCCAGGAGAACCAGGG + Intronic
1104588217 12:130064194-130064216 CAGTTGCTCCCGGTGGCCCCGGG - Intergenic
1104898703 12:132176446-132176468 CAGCTCCTCCAGGAGGACCGTGG - Intergenic
1105303029 13:19152128-19152150 CGGCAGCGCCAGGCTGCCCAGGG + Intergenic
1105572924 13:21621016-21621038 CAGCTCCTCCAGGCAGCAGATGG + Intergenic
1105869687 13:24493632-24493654 CATGTGTTCCAGGTGGCCCAGGG + Exonic
1106035169 13:26037620-26037642 CAGCTGGTCCTGGTGCCCCACGG - Intergenic
1107127495 13:36860898-36860920 GAGATGTTCCAGGCTGCCCAAGG + Intronic
1108095028 13:46892623-46892645 CATGTGCTCCAGGAGGCACAGGG - Intronic
1108394458 13:49979140-49979162 CAGCTGCTTCAGGCCCTCCAGGG - Intergenic
1108500510 13:51065964-51065986 CAGCTGCTCCTGGGGCCACAGGG + Intergenic
1109262774 13:60163726-60163748 CGGCTGCACCACCCGGCCCAAGG - Exonic
1111800474 13:92974725-92974747 CAGCTGCCCATGGCAGCCCATGG - Intergenic
1112807657 13:103180862-103180884 CAGCTCCTCCAAGCGTCCCAGGG + Intergenic
1113464931 13:110506412-110506434 CAGGTGCACCAGGCCGTCCAGGG + Exonic
1113492863 13:110706035-110706057 CCGCTGCTCCAGGCCGCGCTGGG - Exonic
1113517606 13:110915209-110915231 CGGCTGCTCCAGGCGGCCTCCGG - Intergenic
1113766080 13:112881900-112881922 GAGCTGTACCAGGCGGCCGAGGG - Exonic
1114999239 14:28401440-28401462 CAGCTGCTCCTGGGGGCCCTTGG + Intergenic
1116310005 14:43312823-43312845 CAGCTGCTCCAAGAGACCAAAGG - Intergenic
1117094539 14:52283859-52283881 AAGCTCCTCCATGAGGCCCAGGG + Intergenic
1118001387 14:61526788-61526810 GGGGGGCTCCAGGCGGCCCAAGG + Intronic
1118748174 14:68789082-68789104 CAGAGGCTCCGGGAGGCCCACGG + Exonic
1118762668 14:68890251-68890273 CACCTGCTCCAGGCAGCCCCAGG + Exonic
1119023515 14:71135011-71135033 CAGCTGATCCAGGGAGCACAGGG - Intergenic
1122020038 14:98830192-98830214 GAGCTGCTCCAGTCCTCCCAGGG - Intergenic
1122210515 14:100170858-100170880 CAGCTGGACCAGGCTGCCCTGGG + Intergenic
1122262341 14:100530662-100530684 CAGCTCCTCCAGGCTCCTCAAGG - Intergenic
1122308361 14:100779550-100779572 GAGCTGCTCGAGGCAGCCCGTGG - Intergenic
1122449113 14:101789711-101789733 AAGCTGCTCCAGGCCACCCCAGG - Intronic
1122977092 14:105175203-105175225 CACCTCCTCCAGGGGGACCAAGG + Intronic
1124405859 15:29391038-29391060 CAGCTGCTCCAGGAGGCTGTAGG - Intronic
1127427041 15:58867080-58867102 CTGCTGCTCGAGGCGCCTCAGGG - Intronic
1129298012 15:74610371-74610393 CTCCTGCTCCAGGCAGGCCAGGG + Intronic
1129731884 15:77937061-77937083 CACCTGCTCCCTGCAGCCCAGGG - Intergenic
1130883561 15:88075155-88075177 CAGCTGATCCAGGCAGCTGAGGG - Intronic
1132121727 15:99181728-99181750 CAGCTGCCCCAGGCCTCCAAGGG - Intronic
1132224788 15:100132064-100132086 CACATGCTCCAGGCGCCCCACGG + Exonic
1132697642 16:1209068-1209090 CGGCTGCTCCAGGCGCCACTGGG - Exonic
1132734806 16:1379942-1379964 CAGCTGCTCCGGGCGGACTCAGG + Intronic
1132757832 16:1494517-1494539 CAGCTCCTCCAGGCGGCCATGGG - Exonic
1132887878 16:2190397-2190419 CAGCCCCTCCAGGCGGCCTGAGG + Intronic
1133021880 16:2970357-2970379 GAGCTGCCCCAGGCGGGCAAGGG + Intronic
1133118303 16:3590748-3590770 CAGCTGCTCCAGCCCTTCCAGGG - Exonic
1133128990 16:3664673-3664695 CTCCTGCCCCAGGTGGCCCAGGG + Exonic
1133313634 16:4868061-4868083 GAGTTGCTCCAAGCTGCCCAGGG + Intronic
1133345307 16:5065888-5065910 CAGCAGCCCCAGGCTGGCCATGG + Exonic
1134100550 16:11448780-11448802 TAGAGGCTCCAGGAGGCCCAAGG + Intronic
1136103482 16:28012137-28012159 CAGCTGCTCCAAATGCCCCACGG + Intronic
1136315566 16:29453033-29453055 CAGCTGCCCCCGGAGGACCATGG - Intronic
1136430143 16:30192375-30192397 CAGCTGCCCCCGGAGGACCATGG - Intergenic
1136997157 16:35198441-35198463 CAGCTGATCCAGGCCGCTGAGGG - Intergenic
1137323034 16:47405582-47405604 CAGCTTCTCCATGGAGCCCAAGG - Intronic
1137645071 16:50066467-50066489 CAGCGGCCCGAGGCGGCGCACGG - Exonic
1138207065 16:55132944-55132966 CAGTTGCTTTAGGCAGCCCAAGG + Intergenic
1139668143 16:68472592-68472614 CAGCTGCTCCAGCTGGCCTCTGG - Intergenic
1140255167 16:73329499-73329521 CAGCTGCTCCAAGAGGAACACGG + Intergenic
1140887537 16:79258324-79258346 CACCTGCTCCATGGGGACCAGGG + Intergenic
1141125465 16:81397825-81397847 CAGCAGCTCAAGTGGGCCCAGGG - Intergenic
1141524906 16:84604814-84604836 CTGCTGCTTCAGGCGGGCCAGGG - Intronic
1142285028 16:89168186-89168208 CAGCTGCCCCTGGCGGCCACAGG - Intergenic
1142342433 16:89532304-89532326 CAGCTGCTCGCGGGGGCCCCTGG - Intronic
1142374154 16:89698148-89698170 CAGCTGGTGCAGGTGGCCCTGGG - Exonic
1142566214 17:841844-841866 CACCTGCTCTAGGTGGCGCACGG + Intronic
1142621589 17:1168896-1168918 CAGCTCATCCAGGCCTCCCAAGG + Intronic
1142711211 17:1724940-1724962 CATCTCCTCCAGGCCGCCCGGGG - Exonic
1142984988 17:3690234-3690256 CAGAGGCTCCAGGGGACCCAAGG - Intronic
1143291153 17:5830170-5830192 AAGCTGCTCCAGGTGGTCCAGGG - Intronic
1143485733 17:7252570-7252592 AAGCAGCACCAGGCCGCCCAAGG - Exonic
1144062770 17:11598658-11598680 CAGCTGCTCCAGGCCTTCCTGGG + Exonic
1144686335 17:17228564-17228586 CACCTGCTCCATGTGGGCCAAGG + Intronic
1146721753 17:35129038-35129060 CAGCTGCTCCCCACGGCTCAGGG - Intronic
1146957272 17:36942878-36942900 CGGGTGCTCCAGGCCACCCAGGG - Exonic
1147218036 17:38912299-38912321 CAGCCGCTCCATGCGGCGTAAGG - Intronic
1147218459 17:38914414-38914436 CAGCAGCTACCGGCGGCCCCTGG + Exonic
1147374619 17:40016296-40016318 CAGCTGCTCAGGGGAGCCCAGGG - Exonic
1147580025 17:41622910-41622932 CAGCTGGCCCAGGCTGCCCAAGG + Intronic
1148216044 17:45834544-45834566 CAGCTGCTCGTGGCGGCCCAGGG + Intronic
1148341554 17:46876408-46876430 CCACAGCTCTAGGCGGCCCAAGG - Exonic
1148796213 17:50198160-50198182 CAGGTGCACCAGGGGGGCCAGGG + Exonic
1150069647 17:62140064-62140086 CGGCTGCTGCAGGAGGCCCCTGG - Intergenic
1150209290 17:63433467-63433489 CAGCAGCTCCAGCAGCCCCAGGG + Exonic
1151475902 17:74344260-74344282 CCGCAGCTCCAGGTAGCCCAGGG - Exonic
1151477422 17:74352066-74352088 GTGCTGCTCCAGGCGGCGCACGG - Exonic
1151495303 17:74454812-74454834 CAGCTGCTTCAGGCTGGCCTGGG + Intergenic
1151954417 17:77373344-77373366 CAGCTGAGCCAGGGGGCCTAGGG + Intronic
1151977947 17:77492903-77492925 CAGCTCCTCCCGGGGGCCCAGGG + Intronic
1152186204 17:78857703-78857725 CAGCTCCTCCACCCGGCGCAGGG + Intronic
1152783653 17:82237255-82237277 CAGCTGCCCCAGCGGGCTCAGGG - Exonic
1153707135 18:7757528-7757550 CACCTGCTGCTGGCTGCCCAGGG - Intronic
1153774282 18:8439140-8439162 CAGCTGCTCCTGCTGGCCCCTGG - Intergenic
1157566810 18:48683912-48683934 CAGTTGCACCATGAGGCCCAGGG + Intronic
1158263587 18:55635705-55635727 GAGCTTCTCCAGGAGGCCCTTGG - Exonic
1158887399 18:61841057-61841079 CTGCTGCTCCATGTGCCCCATGG - Intronic
1158938332 18:62384877-62384899 CTCCTGCACCGGGCGGCCCATGG - Exonic
1159138948 18:64369484-64369506 CAGCTGCTCCTGGGGGCCCTTGG + Intergenic
1160517530 18:79486767-79486789 CAGGTGCTGCGGGCGGCCCGTGG - Exonic
1160539725 18:79613954-79613976 TCGCTCCTCCAGGCAGCCCAGGG + Intergenic
1160728517 19:629763-629785 CGGCTGCTGCAGGAGGCCCCTGG - Exonic
1160797510 19:952839-952861 CAGCAGCTGCGGGGGGCCCAGGG - Intronic
1160809585 19:1007625-1007647 CAGCTGCACCACCCGGCGCAGGG + Exonic
1160898858 19:1416669-1416691 CTGCCGCTCCAGGTGGCCCCAGG - Intronic
1161162007 19:2767039-2767061 CAGCTGGTCCCTGGGGCCCAGGG - Intronic
1161482653 19:4518542-4518564 CAGCAGCGGCAGGCGGCCAATGG + Intergenic
1161581239 19:5082210-5082232 CAGCGGCTCCAGGGGCTCCAGGG - Intronic
1161595748 19:5150290-5150312 CAGGTGCTCCAGGCAGGCCACGG - Intronic
1161756689 19:6138889-6138911 CAGCTGCTCCAGAGGGGCCTTGG + Intronic
1162321034 19:9970657-9970679 CAGAAGCTCCAGGCGGACCCTGG + Exonic
1162524240 19:11197927-11197949 CCCCTCCCCCAGGCGGCCCAGGG + Intergenic
1162562029 19:11422498-11422520 CAGGTGCTCCAGGCTGTCCTTGG + Exonic
1162754913 19:12852139-12852161 CACCTGCTGGAGGCGGCCGAAGG + Exonic
1163469010 19:17486244-17486266 CAGGTGCTCCAGACGTCGCAGGG + Intronic
1163602882 19:18259289-18259311 GAGCTGCTCCAAGGGGCCCATGG - Intronic
1163758596 19:19121037-19121059 CAGCTGCTCCACCCGGGCCTTGG + Exonic
1163801206 19:19366987-19367009 CAGTTGCTACTGGCGGCCCCTGG + Intergenic
1163843687 19:19627191-19627213 CAGCTCCCACTGGCGGCCCAAGG - Exonic
1165308105 19:35014307-35014329 CAGCAGATCCAAGGGGCCCAGGG - Exonic
1165793963 19:38507762-38507784 CAGCTGCTGCAGGAAGCCAAAGG - Exonic
1166100398 19:40568171-40568193 CATCTGCTCATAGCGGCCCAGGG - Exonic
1166101935 19:40576364-40576386 CGGCTTCTCCAGGCGGCCATGGG - Exonic
1166782909 19:45351680-45351702 TAGCTGCTCCAGGCTGAGCAGGG + Exonic
1167348407 19:48961005-48961027 GACCTGCTCCAGAAGGCCCAGGG - Exonic
1167377034 19:49117888-49117910 GAGCTGCTGAAGGCGGCCCAGGG + Exonic
1167613620 19:50519011-50519033 CAGCTCCTCCAGGCGCACCAGGG + Exonic
1167656832 19:50770432-50770454 CAGCTACTCCAGGAGGCTGAGGG + Intergenic
1168264127 19:55212280-55212302 CAGCTGCTCCAGGAGGACTTTGG - Intergenic
1168324579 19:55531384-55531406 CAGCTGGCCCAGGTGGCCCTTGG - Intronic
1168645011 19:58054019-58054041 CAGAAGCTCCACACGGCCCACGG + Exonic
925278921 2:2669520-2669542 TAGCTGCTCCAAGCGCCCGAGGG + Intergenic
925754064 2:7116967-7116989 CAGCTAGTCCAGGCGTACCAGGG + Intergenic
926181478 2:10648078-10648100 CAGCTGCTCCATGCCGGTCAGGG - Intronic
926309163 2:11662094-11662116 CAGCAGCTCCAGGCGGCTGGGGG + Exonic
927156388 2:20223938-20223960 CAGCTGCACTGGGCGGGCCAAGG + Intronic
927487217 2:23496664-23496686 GAGCTGCCCTAGGGGGCCCAGGG + Intronic
927718404 2:25367514-25367536 CAGCTGCTCCAGGGCGGCCATGG - Intergenic
927826471 2:26313103-26313125 CAGCTGCTGCAGGCAGGCCAGGG - Exonic
927937253 2:27082896-27082918 CAACTGCTCTAGTCGGCCCCGGG - Exonic
932817697 2:74874894-74874916 CAGCTGCAGCAGGAGGCCCTGGG - Intronic
933690377 2:85175075-85175097 GAGCTGCGCCGGGCGGGCCAGGG - Intronic
934296876 2:91749186-91749208 CGGCAGCCCCAGGCGGCCCGGGG + Intergenic
934521801 2:95024634-95024656 CAGCTGCTGCAGGCAGGACAAGG - Intergenic
935134950 2:100291748-100291770 CTCCTGCTCCATGCTGCCCAGGG + Intronic
935671952 2:105563499-105563521 CAACTGCACCAGGCGACCCCTGG + Intergenic
936847282 2:116852601-116852623 CAGCTGCAGCAGGGTGCCCATGG - Intergenic
937060043 2:118974373-118974395 CAGGTGGTCCCGGCGGGCCAGGG - Exonic
938322267 2:130373117-130373139 CAGCTTCTCCATGAGACCCACGG + Intronic
941169039 2:162115671-162115693 CAGCTGCTTCAGGCAGCAGAAGG + Intergenic
943730404 2:191297301-191297323 CAGTTGCTGCAAGGGGCCCACGG + Intronic
943950482 2:194128666-194128688 CAGCTGCCCAAGGCCACCCATGG - Intergenic
946312844 2:218892485-218892507 CAGCAGCTGCAGGGGGCCCTTGG - Intronic
946416759 2:219543729-219543751 CAGCTGCTCTGGGCTGCGCAGGG + Exonic
947072591 2:226307450-226307472 CAGTTGCTCCAGGAGACCCAGGG - Intergenic
947151493 2:227121031-227121053 CTGCTGCTCCAGGAGGGCCGCGG + Exonic
947525095 2:230872777-230872799 CAGGGGCTCCAGGAGCCCCATGG - Intronic
947718268 2:232352505-232352527 CCGCTGTGCCAGGCGGCCCGAGG - Intergenic
947913115 2:233814598-233814620 CAGCTGCTCCAGGGAGCTCAGGG - Exonic
948601899 2:239112086-239112108 CACCTGCTCCAGGCTGCTCCTGG - Intronic
948640177 2:239370709-239370731 CGGCTCCTCCAGGCGCCGCAGGG - Intronic
948805760 2:240452981-240453003 CAGCGGCTCCGGGCGGCGCGCGG - Intronic
948826759 2:240576777-240576799 CAGCTGATGGGGGCGGCCCAGGG + Intronic
948897850 2:240935494-240935516 CCGCTGCTCCAGGCGTCCGCAGG - Intronic
948903502 2:240967415-240967437 CAGCTGCCCCACGCGGCTCTGGG - Intronic
949050744 2:241896141-241896163 CAGAGGCTCCAGGCAGCCCTCGG - Intronic
1168849045 20:964081-964103 CAGGGGCTCCAGCCGCCCCAGGG + Exonic
1169060105 20:2654890-2654912 CAGCTGGTCCAGGAGGCTAATGG - Exonic
1169856154 20:10105569-10105591 CAGCTGCTCAAGGCAAACCATGG - Intergenic
1172644546 20:36461611-36461633 CGGCTGCTCCGGGCGGCGCTGGG - Intronic
1172655266 20:36532997-36533019 CTGCTGCTCCAGGCGGGGCTGGG + Intergenic
1173737987 20:45375201-45375223 CAGCTGCTTCATGTGCCCCATGG + Exonic
1174112261 20:48204984-48205006 CAGCAGCTCCAGGGGGCTCACGG - Intergenic
1174206846 20:48846596-48846618 CAGCCGCTCCTGGCGGTCAAAGG + Intergenic
1175197010 20:57251160-57251182 CACCAGCTGCAGGCGGCCCGAGG + Intronic
1175874905 20:62224740-62224762 CAGATGCTCCAGGAGGGCCTGGG + Intergenic
1176012750 20:62908396-62908418 CAGCAGGTCCAGGCTTCCCATGG + Intronic
1176039443 20:63056556-63056578 CAGCGGCTCCTGGCGGTCGAGGG - Intergenic
1177250376 21:18583993-18584015 CCCCTGCTCCAGGCGGCACAGGG - Intergenic
1178958183 21:37041881-37041903 CAGTTGCTGCAGGCGGCTCTGGG + Intergenic
1179565467 21:42245116-42245138 GAGCCCCTCCAGGCAGCCCAGGG - Intronic
1180326456 22:11434504-11434526 CAGCTGCTCCAAGAGGTCAAAGG + Intergenic
1181014568 22:20061752-20061774 CTGCTGCCCCGGGAGGCCCATGG + Intronic
1181029047 22:20141218-20141240 CAGCCGGTCCAGGCTGCCCTTGG - Exonic
1181491529 22:23263269-23263291 CACCTGGGCCAGGCGGCCGAGGG - Intronic
1181978390 22:26748945-26748967 CAGCTGCCCCTAGCTGCCCAGGG - Intergenic
1183543090 22:38441191-38441213 CAGGTGCTCCAGGCTGGGCAGGG - Intronic
1184426182 22:44410524-44410546 AAGCGGCTCCAGGCGTCCCAGGG + Intergenic
1184580520 22:45413547-45413569 CAGCAGCTCCAGGTGGGCCATGG + Exonic
1184759693 22:46537456-46537478 CGGCGGCTCCAGGCGGCTCCAGG + Intergenic
1184897558 22:47420330-47420352 CAGCAACTCCAGGCTGCCCCAGG + Intergenic
1185398182 22:50603233-50603255 CGGCTGCTCCGAGCGCCCCAGGG - Exonic
950635107 3:14308678-14308700 CAGCTGCTCCAGGGGCTCCTGGG - Intergenic
950654390 3:14427709-14427731 CAGCTGCCCAAGGTGTCCCAGGG + Intronic
950764343 3:15262194-15262216 CAGCTGTCGCATGCGGCCCATGG + Exonic
951562567 3:23982683-23982705 AAGCTGCTCCAGACGGCCCATGG - Intergenic
954035181 3:47847482-47847504 CAGCGCCTCCAGGAGGCCCTGGG + Exonic
954035726 3:47849966-47849988 CCGCTCCACCATGCGGCCCAGGG - Exonic
956179255 3:66501654-66501676 CAGATGCTCCAGGCTGCTCGAGG - Intergenic
963038709 3:141052916-141052938 TGGCTGCTCCCGCCGGCCCATGG + Intronic
963103019 3:141623621-141623643 CAGCAGCCACAGGCGGGCCAAGG - Intergenic
963735293 3:149011878-149011900 CAGCATCTCCAGCCGGCCCTGGG - Intronic
965404167 3:168249664-168249686 CAGTTGCTCCCGGCGGAGCAGGG + Intergenic
968133629 3:196207461-196207483 CAGCGGCACCAGGAGGCCCGCGG + Exonic
969512603 4:7628007-7628029 CAGCTGCTGCAGGCAGGCCCGGG - Intronic
969944307 4:10767292-10767314 CAGTGGCTCCAGTCGCCCCAGGG - Intergenic
971462264 4:26912975-26912997 CAGCTGCTACTGGCGGTCAATGG - Intronic
973337929 4:48975330-48975352 CAGCAGCTCCATGCTGCCAAAGG - Intergenic
973701507 4:53541959-53541981 CAGCTGCTCCAGATGACACATGG + Intronic
977471721 4:97451900-97451922 CAGCTGCTCCAGACAGCCTGTGG + Intronic
977570710 4:98626584-98626606 CTGCTGCACCAGGTGGGCCAGGG - Intronic
978249096 4:106609868-106609890 CAGCTGCACCAGATGGCCCATGG - Intergenic
980073809 4:128271754-128271776 CAGCTGTTCCAAGGGACCCAGGG + Intronic
980497857 4:133607901-133607923 CAGTTGCCTCAGGCAGCCCAGGG + Intergenic
982297854 4:153848318-153848340 CTGCTGCCTCAGGCGGCACAAGG - Intergenic
983184734 4:164689094-164689116 CTGTTGCTTCAGGCAGCCCAGGG - Intergenic
984972633 4:185204234-185204256 CTGCTGCTCCCGGCTGCCTAGGG + Exonic
985688732 5:1295297-1295319 CAGCTGCTCCGGGCGGACCCGGG + Intergenic
985720131 5:1484622-1484644 CAGATGCTCCTGGCAGCCCTAGG - Intronic
995353133 5:111205350-111205372 CAGCTCCTCCAGAGGGACCAAGG + Intergenic
997366214 5:133326881-133326903 CAGGTGCTGCAGCCTGCCCATGG + Intronic
997663662 5:135609348-135609370 CAGCAGCTCCATGAGGGCCAAGG - Intergenic
999327391 5:150651560-150651582 GAGCTGCTGCAGGAGGCCAAGGG + Exonic
1002028333 5:176410772-176410794 CAGTTGCTCAAGGCGCCTCAGGG - Intronic
1002092331 5:176812767-176812789 CAGCTCCTCCCGCAGGCCCAGGG - Intronic
1002535744 5:179874461-179874483 CAGCTGTTCCAGCGGGCCCAGGG + Intronic
1002786153 6:401967-401989 CAGATGGTCCAGGTGGACCATGG + Intronic
1002800112 6:514646-514668 CAGCTGCTCCAGGGGCTCCAGGG + Intronic
1003193309 6:3892876-3892898 CAGCTGCTCCAAGAGGCCTCAGG - Intergenic
1004170465 6:13291873-13291895 CTGCTGCTCCAGGGGCCCCCTGG - Intronic
1004186979 6:13429242-13429264 CAGCTCCTCCAGGCAGCCTGTGG - Intronic
1004485153 6:16059719-16059741 CAGGTGCTCCAGGCCCCCGAGGG + Intergenic
1005569811 6:27133841-27133863 CAGCTGTTCCACGCGGGCCAGGG + Exonic
1005840753 6:29743347-29743369 CAGCTCCTGGAGGAGGCCCATGG + Intergenic
1006295669 6:33168963-33168985 CACCTTCTCCAGGGGGGCCAGGG + Exonic
1006375007 6:33667178-33667200 CAGCTCCTCCAGCCGCACCAGGG - Exonic
1006378830 6:33686138-33686160 CAGCAGCCCCAGGCCGCCCGTGG - Exonic
1007179078 6:39915539-39915561 CACCTGCCTCAGGAGGCCCAAGG - Intronic
1012917139 6:105182181-105182203 CAGCTCCTAGAGGCTGCCCATGG - Intergenic
1017603825 6:156112017-156112039 CAGCAGCTCCTGGCGAGCCAAGG + Intergenic
1018067290 6:160133130-160133152 CAGCTTCACCAGGCTGCTCATGG - Intronic
1019175739 6:170158521-170158543 CAGCTTCTCAAGGCTGCCCATGG - Intergenic
1019379620 7:714017-714039 CAGCAGCTCCAGGCAGGCCAGGG - Intronic
1019380926 7:723047-723069 CAGTGACACCAGGCGGCCCAGGG - Intronic
1019640081 7:2098685-2098707 CCACTGCTCCAGGAGGCCCAAGG + Intronic
1019716489 7:2541727-2541749 CAGCTCCTCCAGGTGAGCCAGGG + Exonic
1019921290 7:4164775-4164797 CAGCTCCTCCAGGTGGCACTAGG - Intronic
1020012941 7:4816316-4816338 CAGCTGCCGCAGGAGGTCCAGGG + Exonic
1023044538 7:36199545-36199567 GAGCTGGCCCAGGCTGCCCAGGG - Intronic
1024980828 7:55156236-55156258 GTGCAGCTCCAAGCGGCCCATGG + Intronic
1027266309 7:76496952-76496974 CAGCTTCCCCAGGAGGCCCTGGG - Intronic
1027268246 7:76505576-76505598 CTGCTGCTCCAGGCAGTCCTCGG - Exonic
1027317689 7:76995070-76995092 CAGCTTCCCCAGGAGGCCCTGGG - Intergenic
1029112156 7:98217933-98217955 CACCTGGTCCAGGGGCCCCACGG + Exonic
1029419889 7:100467025-100467047 CAGCTGCTCCGGGCTGGCCAGGG + Exonic
1029680639 7:102106698-102106720 CAGCTGCTACTGGCAGCACACGG + Intronic
1033446420 7:141426412-141426434 CAACTGCTCCAGGAACCCCAAGG + Intronic
1034270640 7:149802057-149802079 CAGCTGCTCCAGACAGACCAGGG - Intergenic
1034276484 7:149826130-149826152 CAACTGCTCCAGGCTGACCAAGG - Intergenic
1034450049 7:151132432-151132454 CTGCTGCTCCTGGCAGCCCTGGG - Intronic
1035166426 7:156993128-156993150 CAGCTGCTCCAGCTGCCCCTAGG - Intergenic
1036225119 8:6951485-6951507 CATCTGCTCCAGGCTGCTCCTGG + Intergenic
1036229553 8:6988157-6988179 CATCTGCTCCAGGCTGCTCCTGG + Intergenic
1036232004 8:7007260-7007282 CATCTGCTCCAGGCTGCTCCTGG + Intronic
1036558803 8:9884188-9884210 CAGCTCCTCCAGGGTTCCCAGGG - Intergenic
1036801699 8:11797251-11797273 CCGCTGCTGCAGGCAGTCCAAGG - Intronic
1037465682 8:19157689-19157711 CTGCTGCTCCAGGCTGCCTTTGG - Intergenic
1037787723 8:21912442-21912464 CTGCAGCTCCAGCCGGGCCAAGG + Exonic
1039773914 8:40716884-40716906 CAGTTTCTCCAGGAAGCCCATGG + Intronic
1039804934 8:40989730-40989752 CTGCTGGTCAGGGCGGCCCAGGG - Intergenic
1040518188 8:48151504-48151526 CACCTGCTCCAGGCGATCCTGGG - Intergenic
1045273439 8:100680971-100680993 CAGCTGCTTCAGGAGCCCCCTGG + Intergenic
1045325725 8:101116369-101116391 CACCTGCTCCTGGCTGTCCAGGG - Intergenic
1045522304 8:102913968-102913990 CCGCTGCGGCAGGCGGCCCGGGG + Intronic
1045782724 8:105886671-105886693 CAGCTGCTCCAGACGGGCTGCGG - Intergenic
1046214924 8:111131578-111131600 CAGCTGCTCCAGAAGACCCCTGG + Intergenic
1046407424 8:113791531-113791553 CAGCAGCTCCAGATGGGCCACGG + Intergenic
1048984751 8:139729487-139729509 CATCTGCTCGAGGCTCCCCAGGG - Intergenic
1049093629 8:140535089-140535111 CAGCTGCTGCAGGGGCCGCATGG - Intronic
1049562972 8:143321280-143321302 CAGCTGCACCCGGAGGCCGATGG - Exonic
1049655146 8:143793944-143793966 CAGCTGCTCCAGACGGTACCTGG + Exonic
1049745544 8:144261712-144261734 GAGCTTCACCAGGCGGCCCAGGG - Exonic
1049799935 8:144513015-144513037 CACCTGCACCAGGCCGCCCTCGG - Exonic
1057721500 9:97535488-97535510 CACCTCCTCCAGGAAGCCCAGGG + Intronic
1059799670 9:117737581-117737603 CTGCTGTTCCAGGCAGCCCAGGG - Intergenic
1060594599 9:124840590-124840612 CAACTGCTCCAGGCTGCCCGAGG + Intergenic
1060727573 9:126016469-126016491 CAGCTGGGCCAGGGGGCCAAGGG + Intergenic
1060970326 9:127734194-127734216 CACCTGCTCCAGGCCACACACGG - Intronic
1061130507 9:128705457-128705479 CAGCTGCTCCAGGCGGCGGTTGG - Exonic
1061673466 9:132202307-132202329 CAGCAGCTGCAGCCAGCCCAGGG + Intronic
1062321168 9:135991117-135991139 CAGCTTCCCCAGGCTCCCCATGG + Intergenic
1062502697 9:136858137-136858159 CAGCGGGTCCAGGCAGCCCTCGG - Intronic
1062536595 9:137023779-137023801 CAGCAGCTGCGGGGGGCCCATGG - Intronic
1062537696 9:137028120-137028142 CAGCTGGTGCAGGAAGCCCATGG + Exonic
1062543038 9:137049912-137049934 CAGCTGCTGCAGGGTGGCCACGG + Exonic
1062722635 9:138052402-138052424 CAGCAGGACCAGGCGGCACAGGG + Intronic
1062733132 9:138120422-138120444 CAGGGGGTCCAAGCGGCCCATGG + Intronic
1185460852 X:332245-332267 CAGCTGCTCAAGGCGCAGCAGGG - Intergenic
1185872019 X:3672618-3672640 CTCCTGCTCCAGGAGGCGCAGGG + Intronic
1187499720 X:19829792-19829814 CAGCAGCTCCAGGCAGCTCTCGG - Intronic
1190023845 X:46904012-46904034 CAGTGGCACCAGACGGCCCAGGG + Intergenic
1191255985 X:58279830-58279852 CAGCTGCTGCACCCAGCCCAAGG - Intergenic
1192698898 X:73447330-73447352 CAGCTGGGACAGGCGGCACAGGG + Exonic
1193294845 X:79822038-79822060 AAGCTCCTCCATGGGGCCCAGGG - Intergenic
1195559183 X:106263861-106263883 CAGCTGCTCCAGGAGAGCAATGG + Intergenic
1200048933 X:153418252-153418274 TGGCTGCTCCAGGCTGCCCTGGG + Intergenic
1200161584 X:154012548-154012570 CAGCAGCTGCAGGCTGTCCAGGG + Exonic