ID: 1071299595

View in Genome Browser
Species Human (GRCh38)
Location 10:84246386-84246408
Sequence CTGGAGACTCAGAAGGGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071299595_1071299603 16 Left 1071299595 10:84246386-84246408 CCCTTCCCCTTCTGAGTCTCCAG No data
Right 1071299603 10:84246425-84246447 TGAATGCCTTTGCGTACTCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071299595 Original CRISPR CTGGAGACTCAGAAGGGGAA GGG (reversed) Intronic
No off target data available for this crispr