ID: 1071300770

View in Genome Browser
Species Human (GRCh38)
Location 10:84254307-84254329
Sequence GTTTCTACAGGGAGAGCGGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 134}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071300770 Original CRISPR GTTTCTACAGGGAGAGCGGG TGG (reversed) Exonic
901468420 1:9438742-9438764 GCTTCTACAGGGAGAGGAGCCGG - Intergenic
902871688 1:19317581-19317603 GGTTCTACAGGGAGGAAGGGAGG - Exonic
904265735 1:29317729-29317751 GCGTCTACAGGGAGCGGGGGTGG - Exonic
904276924 1:29390913-29390935 ATTTCTGCAGGGAGGGTGGGTGG + Intergenic
904454103 1:30636575-30636597 GCTGCTGCAGGGAGAGTGGGTGG + Intergenic
907384675 1:54118334-54118356 GTTCCTGCAGGGGGAGGGGGAGG - Intergenic
914946455 1:152071115-152071137 GTTTGTACAGGCAGTGTGGGTGG - Intergenic
915603152 1:156935168-156935190 TTTTCTACAGGGACAGGGTGGGG + Exonic
918284467 1:183038362-183038384 TTTCTTACAGGGAGAGTGGGTGG + Intronic
919794038 1:201310545-201310567 ATTTGTGCAGGGAGAGCTGGTGG + Intronic
919914380 1:202130629-202130651 GTTTCTACAGACAGAGCTGGGGG - Exonic
1063451634 10:6154089-6154111 GCTTCTGCAGGGTGAGAGGGTGG + Intronic
1063494962 10:6498555-6498577 GTGTCTACAGGAAGAGAGAGGGG + Exonic
1068577197 10:58697882-58697904 GTCTCTACAGGGGGTGTGGGTGG - Intronic
1069062053 10:63904624-63904646 ATTTCTCCAGGGAGAGCTGATGG + Intergenic
1070874504 10:79790112-79790134 GTTTCTACACCAAGAGCTGGAGG - Intergenic
1071300770 10:84254307-84254329 GTTTCTACAGGGAGAGCGGGTGG - Exonic
1071430244 10:85601425-85601447 GTTTCCTCAGGGAGACTGGGCGG - Exonic
1072010721 10:91300840-91300862 GTGTCTACAGAGAGAGAGAGAGG + Intergenic
1072811987 10:98469002-98469024 CTTTATACAAGGAGAGCTGGGGG + Intronic
1073076706 10:100828957-100828979 GTATCTACAGGCAGGGCCGGCGG - Exonic
1073292821 10:102421677-102421699 GTCTCTCCTGGGAGAGCAGGAGG + Intronic
1074765198 10:116695140-116695162 TTGTCTGCAGGGAGAGAGGGAGG - Intronic
1075118978 10:119651039-119651061 GTTTGTACAGGAAGGACGGGCGG + Intergenic
1077240149 11:1506562-1506584 GTTTCTGCAGGGAGAGCCACTGG + Intergenic
1078405680 11:11068117-11068139 GCTTCTGCAGGGAGAGTGGAGGG + Intergenic
1083729525 11:64645221-64645243 GGTTCCACAGGGAGGGAGGGAGG + Intronic
1084081427 11:66828172-66828194 GTTTATACAGGGAGATGAGGAGG - Intronic
1084411378 11:69008121-69008143 GCTTCTCCAGGGAGCGGGGGAGG - Intronic
1087354123 11:97073015-97073037 GTTTCCACTGGGAGATCTGGTGG + Intergenic
1087735145 11:101824237-101824259 GATGCTACGGGGAGAGCCGGGGG + Intronic
1089018734 11:115189113-115189135 GTTCCTGCAGGGAGTGGGGGAGG + Intronic
1089621913 11:119727435-119727457 GTTTCTACCCAGAGAGCTGGAGG + Intronic
1096061565 12:48704958-48704980 GTTTTTACATGGACAGGGGGTGG - Intronic
1096630321 12:52922293-52922315 CTGTCTTCAGGGAGAGAGGGAGG - Intronic
1097086342 12:56471167-56471189 GTTTCTTCAGGGAGAGGAAGAGG + Exonic
1099032934 12:77551066-77551088 GTTTCTAATGGGAGAGGAGGTGG + Intergenic
1103882242 12:124175078-124175100 GATTCCACAGGCAAAGCGGGTGG - Intronic
1104667060 12:130655137-130655159 GTCTCTACAGGGAGAGAATGGGG + Intronic
1105310392 13:19202956-19202978 GTTTATACAGGGAGATAAGGAGG - Intergenic
1108755899 13:53501981-53502003 GATTCAACAGGGTGAGAGGGTGG - Intergenic
1109284931 13:60397779-60397801 GTTTCTGCAGCGGGATCGGGAGG + Intronic
1113028963 13:105972974-105972996 GAATCTACAGGGAGAGCTAGGGG + Intergenic
1115032640 14:28815235-28815257 TTTTCTACCGGGTGAGAGGGTGG + Intergenic
1118678183 14:68211333-68211355 GTTTCAATGGGGAAAGCGGGTGG - Intronic
1118723277 14:68609095-68609117 GCTTCTAGAGGGAGAGGCGGGGG - Intronic
1118739384 14:68727996-68728018 GATTCTGCAGGGACAGTGGGGGG + Intronic
1120749923 14:88187845-88187867 GGTTTTGCAGGGGGAGCGGGGGG - Intronic
1121052660 14:90829728-90829750 GTTTCTACAGTGAGGGGTGGGGG + Intergenic
1121308864 14:92923973-92923995 GTTTCCAAAGGGGGAGGGGGAGG + Intronic
1122517458 14:102318954-102318976 CTTTCCCCAGGGAGAGCAGGAGG - Intronic
1124121182 15:26890563-26890585 GTGCCTACAGGGAGATCGGCGGG - Intronic
1125880476 15:43189664-43189686 GATTCTACAGGCAGGGCTGGAGG - Intronic
1128629830 15:69253320-69253342 GTTCCCACAGGGTGAGTGGGTGG - Intronic
1129107716 15:73320808-73320830 ACTTCAACAGGGAGAGAGGGAGG - Exonic
1129737230 15:77973161-77973183 ATTTCTACAGGGAGAGAGGCAGG + Intergenic
1129848848 15:78780474-78780496 ATTTCTACAGGGAGAGAGGCAGG - Intronic
1130253104 15:82313606-82313628 ATTTCTACAGGGAGAGAGGCAGG + Intergenic
1131262095 15:90892808-90892830 GTTTCTACAGGAAGCGAGGTGGG + Exonic
1133150312 16:3823502-3823524 CTCTCTGCAGGGAGGGCGGGAGG + Intronic
1133175171 16:4009076-4009098 ATTTTTACAAGGAGAGAGGGAGG - Intronic
1137912364 16:52391134-52391156 GAGTCAACAGGGAGAGTGGGAGG - Intergenic
1138135183 16:54515380-54515402 ACTTCTGCTGGGAGAGCGGGTGG + Intergenic
1139044342 16:63038524-63038546 GTTTCTGTAGGGCGAGAGGGAGG + Intergenic
1141733890 16:85839813-85839835 GTTGCTGCTGGGGGAGCGGGCGG + Intergenic
1141987441 16:87589095-87589117 GTCTCCATACGGAGAGCGGGTGG + Intergenic
1143988404 17:10935500-10935522 GTTTCTCCTGGGAGACTGGGAGG + Intergenic
1148859129 17:50594974-50594996 TTTCCTACAGGGAAAGGGGGAGG - Exonic
1151340450 17:73467576-73467598 GCTTCTACAGCTAGAGAGGGAGG + Intronic
1152777625 17:82212709-82212731 TTTTCTACAGGAAGAGTGGTCGG + Intronic
1152882098 17:82823533-82823555 CGTTCTACAGGGAGGGAGGGAGG - Intronic
1156321455 18:36028925-36028947 CTTTCATCAGGGAGAGCGGAAGG + Intronic
1164725578 19:30463703-30463725 GTTCTTACAGGAAGAGCGGTGGG - Intronic
1167665978 19:50823045-50823067 GTTTTTCCTGGGAGAGCTGGGGG + Intronic
1168160502 19:54507554-54507576 CTTTCTAGAGGGACAGAGGGTGG - Intronic
925054434 2:846275-846297 GTTGCTGCGTGGAGAGCGGGTGG + Intergenic
926300206 2:11596731-11596753 GTTTGTACAGTGAGAGGGGGTGG + Intronic
926300252 2:11596913-11596935 GTGTGTACAGTGAGAGGGGGCGG + Intronic
931429932 2:62200706-62200728 GTTCCTTCAGGGTGAGGGGGTGG - Intronic
931546082 2:63389189-63389211 GTTTCTGCAGGGAGATCTGCTGG - Intronic
935816148 2:106847801-106847823 GATTCCACAGGGAAAGAGGGTGG - Intronic
936863986 2:117056176-117056198 GTTTTTACAGGCAGAGGGTGGGG + Intergenic
946725994 2:222661925-222661947 TTTTCTCCAGGGAGACCGGCAGG + Intergenic
948923071 2:241075399-241075421 GATCCTACAGGCAGAACGGGTGG + Intronic
1171102121 20:22394169-22394191 GTTCCTACTGTGAGAGCTGGAGG - Intergenic
1171858965 20:30377163-30377185 GTTTCTGCCGGGAGGGGGGGGGG - Exonic
1175739848 20:61412902-61412924 GTTTCTCCAGGGAGACCCTGAGG + Intronic
1177476239 21:21627403-21627425 GTTTCAACAGAGAGAGACGGAGG + Intergenic
1178061672 21:28859794-28859816 TTTTCTATATGGAGAGCTGGGGG - Intergenic
1178493454 21:33068778-33068800 GATGCTACAGGCAGAGCTGGGGG + Intergenic
1179655699 21:42842886-42842908 GATTCTGCAGGGACAGCAGGAGG + Intergenic
1180971365 22:19817719-19817741 CTATCTCCAGGGAGAGCAGGTGG + Intronic
1182352877 22:29708829-29708851 GCCTCTACAGGCAGAGGGGGAGG - Intergenic
1185069104 22:48646678-48646700 CTTTCTACACGCACAGCGGGCGG - Exonic
950465358 3:13150004-13150026 GGTTCTAGAGGGAGAGTGGGAGG + Intergenic
952746867 3:36789971-36789993 TTTTCTACAGGGTGAGGAGGAGG - Intergenic
953901277 3:46845579-46845601 GTTTCTACTGGGAAAGCAGCGGG - Intergenic
957008594 3:74979929-74979951 GATGCTTCAGGGAAAGCGGGAGG - Intergenic
957036635 3:75299220-75299242 GTTTCTACAGGGGGCAGGGGAGG + Intergenic
962687753 3:137863598-137863620 ATTTGTGAAGGGAGAGCGGGGGG - Intergenic
975717457 4:77218582-77218604 TTTTCTTCAGGGAAAGCAGGGGG + Intronic
979283577 4:118895491-118895513 GTTTCTTCCGGGAGAGCTAGAGG + Intronic
985552218 5:539547-539569 GTTACTACAGCCAGAGAGGGTGG - Intergenic
986894123 5:12345432-12345454 ATTTGTACTGGGAGAGAGGGGGG + Intergenic
988804682 5:34729006-34729028 GTTTCTACAGGGAATGAGTGAGG + Intronic
1001775775 5:174328101-174328123 GTTTCTGCAGGGAAGGCTGGAGG + Intergenic
1002439306 5:179256100-179256122 CTTCCCACAGGGAGACCGGGAGG + Intronic
1002963939 6:1943495-1943517 TTTTCTGCAGGGAGAGGGAGGGG + Intronic
1004505922 6:16246537-16246559 GTTTCTATAGGGCTTGCGGGTGG + Intronic
1010762134 6:79735464-79735486 GTTTCAACAGGTAGAGTGTGTGG - Intergenic
1014216832 6:118760805-118760827 GTTTCCACAGGGAGGGGGGTGGG - Intergenic
1017739306 6:157392795-157392817 GTCTCTAGAGGGAGACAGGGAGG - Intronic
1018450371 6:163901679-163901701 GGTTCTCCAGGGAGAGCGCGGGG + Intergenic
1018958424 6:168429737-168429759 GTTTCTTTAGGGACATCGGGCGG + Intergenic
1018962558 6:168458758-168458780 GTTCCTAGAAGGAGAGCTGGGGG - Intronic
1019449107 7:1087257-1087279 GCTTCTGCAGCGAGCGCGGGAGG + Intronic
1020230959 7:6318095-6318117 GGCTCTAGAGGGAGAGGGGGCGG + Intergenic
1021612584 7:22472729-22472751 GTTTCTGCTGGGAGAGGGGTAGG - Intronic
1022698929 7:32738441-32738463 ATTTGGACAGGGAGAGAGGGAGG + Intergenic
1023361930 7:39426101-39426123 ATTCCAACAGGGAGAGCAGGAGG - Intronic
1024491600 7:49991877-49991899 ATTTCTACAGTAAGAGAGGGTGG + Intronic
1026586760 7:71661775-71661797 GACTCTACAGGGAGAGCTGAGGG + Intronic
1027260113 7:76458850-76458872 GTATCAAGAGGGAGAGTGGGGGG - Intergenic
1027311488 7:76956954-76956976 GTATCAAGAGGGAGAGTGGGGGG - Intergenic
1027976303 7:85160531-85160553 GTTTCTACAGGCAGAGAGTCAGG - Intronic
1032461867 7:132117843-132117865 GCTTCTACATGGAGGGCAGGGGG + Intergenic
1032645622 7:133820750-133820772 GATTCTCCAGGGAGGGTGGGAGG + Intronic
1033643816 7:143286249-143286271 GAGACTACAGGGAGAGAGGGAGG - Intronic
1036227891 8:6975298-6975320 GTTGCAACAGGGAGAGCCGTTGG + Intergenic
1036230344 8:6994415-6994437 GTTGCAACAGGGAGAGCCGTTGG + Intergenic
1036232796 8:7013518-7013540 GTTGCAACAGGGAGAGCCGTTGG + Intronic
1041464172 8:58142494-58142516 GTTTGTGCAGGGAGAACAGGTGG - Intronic
1043316824 8:78932879-78932901 GTTTCTCCAGGGAGATCATGCGG - Intergenic
1044506355 8:93024441-93024463 GTATCCACAGGGAGAGCAGCTGG + Intergenic
1049040838 8:140110854-140110876 GCTGCTACAGGGGGTGCGGGGGG - Intronic
1049851926 8:144837250-144837272 GCTCCTGCAGGGAGAGTGGGTGG - Intronic
1055290502 9:74778078-74778100 GTTTCCACTGGGACAGCTGGAGG - Intronic
1058439257 9:104992020-104992042 GTTTCTCCACAGAGAGTGGGTGG - Intergenic
1059537616 9:115097234-115097256 GTATCTCCAGGGAGAGGAGGCGG - Intronic
1060948012 9:127581782-127581804 GATTACACAGGGAGAGAGGGAGG - Intergenic
1061305491 9:129730357-129730379 GTTGCTACAGGGAGACAGGGAGG - Intergenic
1192149343 X:68702274-68702296 GATTCTAAAGGGAGAGCCGAGGG + Intronic
1195048816 X:101078912-101078934 GTTAGCACAGGGAGAGCTGGGGG - Exonic