ID: 1071307967

View in Genome Browser
Species Human (GRCh38)
Location 10:84315867-84315889
Sequence AGCATTCTTCCCCCAGGGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071307967_1071307975 26 Left 1071307967 10:84315867-84315889 CCATTCCCTGGGGGAAGAATGCT No data
Right 1071307975 10:84315916-84315938 CAAGATGCCTGAGTTCAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071307967 Original CRISPR AGCATTCTTCCCCCAGGGAA TGG (reversed) Intergenic
No off target data available for this crispr