ID: 1071307970

View in Genome Browser
Species Human (GRCh38)
Location 10:84315873-84315895
Sequence GACCTCAGCATTCTTCCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071307970_1071307977 27 Left 1071307970 10:84315873-84315895 CCTGGGGGAAGAATGCTGAGGTC No data
Right 1071307977 10:84315923-84315945 CCTGAGTTCAGAGAGGTTCCAGG No data
1071307970_1071307975 20 Left 1071307970 10:84315873-84315895 CCTGGGGGAAGAATGCTGAGGTC No data
Right 1071307975 10:84315916-84315938 CAAGATGCCTGAGTTCAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071307970 Original CRISPR GACCTCAGCATTCTTCCCCC AGG (reversed) Intergenic
No off target data available for this crispr