ID: 1071307971

View in Genome Browser
Species Human (GRCh38)
Location 10:84315895-84315917
Sequence TGGCTTTTCATGGAAGCTTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071307971_1071307975 -2 Left 1071307971 10:84315895-84315917 CCCGAAGCTTCCATGAAAAGCCA No data
Right 1071307975 10:84315916-84315938 CAAGATGCCTGAGTTCAGAGAGG No data
1071307971_1071307978 20 Left 1071307971 10:84315895-84315917 CCCGAAGCTTCCATGAAAAGCCA No data
Right 1071307978 10:84315938-84315960 GTTCCAGGTAGCTGAATACATGG No data
1071307971_1071307977 5 Left 1071307971 10:84315895-84315917 CCCGAAGCTTCCATGAAAAGCCA No data
Right 1071307977 10:84315923-84315945 CCTGAGTTCAGAGAGGTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071307971 Original CRISPR TGGCTTTTCATGGAAGCTTC GGG (reversed) Intergenic