ID: 1071307972

View in Genome Browser
Species Human (GRCh38)
Location 10:84315896-84315918
Sequence TTGGCTTTTCATGGAAGCTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071307972_1071307978 19 Left 1071307972 10:84315896-84315918 CCGAAGCTTCCATGAAAAGCCAA No data
Right 1071307978 10:84315938-84315960 GTTCCAGGTAGCTGAATACATGG No data
1071307972_1071307977 4 Left 1071307972 10:84315896-84315918 CCGAAGCTTCCATGAAAAGCCAA No data
Right 1071307977 10:84315923-84315945 CCTGAGTTCAGAGAGGTTCCAGG No data
1071307972_1071307975 -3 Left 1071307972 10:84315896-84315918 CCGAAGCTTCCATGAAAAGCCAA No data
Right 1071307975 10:84315916-84315938 CAAGATGCCTGAGTTCAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071307972 Original CRISPR TTGGCTTTTCATGGAAGCTT CGG (reversed) Intergenic