ID: 1071307973

View in Genome Browser
Species Human (GRCh38)
Location 10:84315905-84315927
Sequence TCAGGCATCTTGGCTTTTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071307973_1071307977 -5 Left 1071307973 10:84315905-84315927 CCATGAAAAGCCAAGATGCCTGA No data
Right 1071307977 10:84315923-84315945 CCTGAGTTCAGAGAGGTTCCAGG No data
1071307973_1071307978 10 Left 1071307973 10:84315905-84315927 CCATGAAAAGCCAAGATGCCTGA No data
Right 1071307978 10:84315938-84315960 GTTCCAGGTAGCTGAATACATGG No data
1071307973_1071307980 22 Left 1071307973 10:84315905-84315927 CCATGAAAAGCCAAGATGCCTGA No data
Right 1071307980 10:84315950-84315972 TGAATACATGGAAGTTTCTGAGG No data
1071307973_1071307981 27 Left 1071307973 10:84315905-84315927 CCATGAAAAGCCAAGATGCCTGA No data
Right 1071307981 10:84315955-84315977 ACATGGAAGTTTCTGAGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071307973 Original CRISPR TCAGGCATCTTGGCTTTTCA TGG (reversed) Intergenic