ID: 1071307974

View in Genome Browser
Species Human (GRCh38)
Location 10:84315915-84315937
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071307974_1071307981 17 Left 1071307974 10:84315915-84315937 CCAAGATGCCTGAGTTCAGAGAG No data
Right 1071307981 10:84315955-84315977 ACATGGAAGTTTCTGAGGAGTGG No data
1071307974_1071307978 0 Left 1071307974 10:84315915-84315937 CCAAGATGCCTGAGTTCAGAGAG No data
Right 1071307978 10:84315938-84315960 GTTCCAGGTAGCTGAATACATGG No data
1071307974_1071307980 12 Left 1071307974 10:84315915-84315937 CCAAGATGCCTGAGTTCAGAGAG No data
Right 1071307980 10:84315950-84315972 TGAATACATGGAAGTTTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071307974 Original CRISPR CTCTCTGAACTCAGGCATCT TGG (reversed) Intergenic