ID: 1071307975

View in Genome Browser
Species Human (GRCh38)
Location 10:84315916-84315938
Sequence CAAGATGCCTGAGTTCAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071307969_1071307975 21 Left 1071307969 10:84315872-84315894 CCCTGGGGGAAGAATGCTGAGGT No data
Right 1071307975 10:84315916-84315938 CAAGATGCCTGAGTTCAGAGAGG No data
1071307970_1071307975 20 Left 1071307970 10:84315873-84315895 CCTGGGGGAAGAATGCTGAGGTC No data
Right 1071307975 10:84315916-84315938 CAAGATGCCTGAGTTCAGAGAGG No data
1071307971_1071307975 -2 Left 1071307971 10:84315895-84315917 CCCGAAGCTTCCATGAAAAGCCA No data
Right 1071307975 10:84315916-84315938 CAAGATGCCTGAGTTCAGAGAGG No data
1071307967_1071307975 26 Left 1071307967 10:84315867-84315889 CCATTCCCTGGGGGAAGAATGCT No data
Right 1071307975 10:84315916-84315938 CAAGATGCCTGAGTTCAGAGAGG No data
1071307972_1071307975 -3 Left 1071307972 10:84315896-84315918 CCGAAGCTTCCATGAAAAGCCAA No data
Right 1071307975 10:84315916-84315938 CAAGATGCCTGAGTTCAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071307975 Original CRISPR CAAGATGCCTGAGTTCAGAG AGG Intergenic
No off target data available for this crispr