ID: 1071307976

View in Genome Browser
Species Human (GRCh38)
Location 10:84315923-84315945
Sequence CCTGGAACCTCTCTGAACTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071307976_1071307980 4 Left 1071307976 10:84315923-84315945 CCTGAGTTCAGAGAGGTTCCAGG No data
Right 1071307980 10:84315950-84315972 TGAATACATGGAAGTTTCTGAGG No data
1071307976_1071307981 9 Left 1071307976 10:84315923-84315945 CCTGAGTTCAGAGAGGTTCCAGG No data
Right 1071307981 10:84315955-84315977 ACATGGAAGTTTCTGAGGAGTGG No data
1071307976_1071307978 -8 Left 1071307976 10:84315923-84315945 CCTGAGTTCAGAGAGGTTCCAGG No data
Right 1071307978 10:84315938-84315960 GTTCCAGGTAGCTGAATACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071307976 Original CRISPR CCTGGAACCTCTCTGAACTC AGG (reversed) Intergenic