ID: 1071307977

View in Genome Browser
Species Human (GRCh38)
Location 10:84315923-84315945
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071307972_1071307977 4 Left 1071307972 10:84315896-84315918 CCGAAGCTTCCATGAAAAGCCAA No data
Right 1071307977 10:84315923-84315945 CCTGAGTTCAGAGAGGTTCCAGG No data
1071307970_1071307977 27 Left 1071307970 10:84315873-84315895 CCTGGGGGAAGAATGCTGAGGTC No data
Right 1071307977 10:84315923-84315945 CCTGAGTTCAGAGAGGTTCCAGG No data
1071307971_1071307977 5 Left 1071307971 10:84315895-84315917 CCCGAAGCTTCCATGAAAAGCCA No data
Right 1071307977 10:84315923-84315945 CCTGAGTTCAGAGAGGTTCCAGG No data
1071307969_1071307977 28 Left 1071307969 10:84315872-84315894 CCCTGGGGGAAGAATGCTGAGGT No data
Right 1071307977 10:84315923-84315945 CCTGAGTTCAGAGAGGTTCCAGG No data
1071307973_1071307977 -5 Left 1071307973 10:84315905-84315927 CCATGAAAAGCCAAGATGCCTGA No data
Right 1071307977 10:84315923-84315945 CCTGAGTTCAGAGAGGTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071307977 Original CRISPR CCTGAGTTCAGAGAGGTTCC AGG Intergenic