ID: 1071307978

View in Genome Browser
Species Human (GRCh38)
Location 10:84315938-84315960
Sequence GTTCCAGGTAGCTGAATACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071307973_1071307978 10 Left 1071307973 10:84315905-84315927 CCATGAAAAGCCAAGATGCCTGA No data
Right 1071307978 10:84315938-84315960 GTTCCAGGTAGCTGAATACATGG No data
1071307974_1071307978 0 Left 1071307974 10:84315915-84315937 CCAAGATGCCTGAGTTCAGAGAG No data
Right 1071307978 10:84315938-84315960 GTTCCAGGTAGCTGAATACATGG No data
1071307972_1071307978 19 Left 1071307972 10:84315896-84315918 CCGAAGCTTCCATGAAAAGCCAA No data
Right 1071307978 10:84315938-84315960 GTTCCAGGTAGCTGAATACATGG No data
1071307971_1071307978 20 Left 1071307971 10:84315895-84315917 CCCGAAGCTTCCATGAAAAGCCA No data
Right 1071307978 10:84315938-84315960 GTTCCAGGTAGCTGAATACATGG No data
1071307976_1071307978 -8 Left 1071307976 10:84315923-84315945 CCTGAGTTCAGAGAGGTTCCAGG No data
Right 1071307978 10:84315938-84315960 GTTCCAGGTAGCTGAATACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071307978 Original CRISPR GTTCCAGGTAGCTGAATACA TGG Intergenic