ID: 1071307980

View in Genome Browser
Species Human (GRCh38)
Location 10:84315950-84315972
Sequence TGAATACATGGAAGTTTCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071307974_1071307980 12 Left 1071307974 10:84315915-84315937 CCAAGATGCCTGAGTTCAGAGAG No data
Right 1071307980 10:84315950-84315972 TGAATACATGGAAGTTTCTGAGG No data
1071307976_1071307980 4 Left 1071307976 10:84315923-84315945 CCTGAGTTCAGAGAGGTTCCAGG No data
Right 1071307980 10:84315950-84315972 TGAATACATGGAAGTTTCTGAGG No data
1071307973_1071307980 22 Left 1071307973 10:84315905-84315927 CCATGAAAAGCCAAGATGCCTGA No data
Right 1071307980 10:84315950-84315972 TGAATACATGGAAGTTTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071307980 Original CRISPR TGAATACATGGAAGTTTCTG AGG Intergenic