ID: 1071312230

View in Genome Browser
Species Human (GRCh38)
Location 10:84353634-84353656
Sequence GTGGTAGCCATGCTAATTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071312230_1071312236 22 Left 1071312230 10:84353634-84353656 CCTGCAATTAGCATGGCTACCAC No data
Right 1071312236 10:84353679-84353701 ATCAAGCTGCCACTTTCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071312230 Original CRISPR GTGGTAGCCATGCTAATTGC AGG (reversed) Intronic
No off target data available for this crispr