ID: 1071321350

View in Genome Browser
Species Human (GRCh38)
Location 10:84462378-84462400
Sequence CTTCTTCCCAACTGCAATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 5, 3: 59, 4: 198}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071321350_1071321351 -7 Left 1071321350 10:84462378-84462400 CCTGCATTGCAGTTGGGAAGAAG 0: 1
1: 0
2: 5
3: 59
4: 198
Right 1071321351 10:84462394-84462416 GAAGAAGACATTTAGATATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071321350 Original CRISPR CTTCTTCCCAACTGCAATGC AGG (reversed) Intronic
903662489 1:24986828-24986850 CTTCTTACAAACTGCAAAGAAGG + Intergenic
904342895 1:29849301-29849323 CTACCTCCCAACTGAATTGCAGG - Intergenic
906935822 1:50213260-50213282 ATTCTTCCCATTTGGAATGCTGG + Intergenic
909419742 1:75450553-75450575 CTACCCCCCAACTGCAATCCTGG + Intronic
910773293 1:90851225-90851247 CTCCTCCCCAACTGCAACGTGGG + Intergenic
913227143 1:116710318-116710340 CCTCTCCCCACCTGCAAGGCAGG + Intergenic
916445475 1:164868063-164868085 CTTCCTCCCACATGAAATGCTGG - Intronic
917066511 1:171100493-171100515 CTTCTTCCAAAATACAATGGTGG - Intronic
919838697 1:201593967-201593989 CCTCTTCCCACCTGCACTGATGG - Intergenic
924660912 1:246016012-246016034 ATTCTTGCTAACTGGAATGCTGG + Intronic
1063080691 10:2764629-2764651 CTTCTTCCCACCTGGTAGGCAGG - Intergenic
1066364545 10:34764100-34764122 CATCTTCCCAACTAGCATGCAGG - Intronic
1068594331 10:58886645-58886667 CTTCTACCAAATTGCAAGGCAGG - Intergenic
1068803601 10:61170060-61170082 CTTCTTCTGAAATGCAAGGCAGG + Intergenic
1069629254 10:69887954-69887976 CTTTCTCCCAACCTCAATGCAGG + Intronic
1071321350 10:84462378-84462400 CTTCTTCCCAACTGCAATGCAGG - Intronic
1072521066 10:96230537-96230559 CTTATGCCCAACTTCAGTGCTGG - Intronic
1072572628 10:96672135-96672157 CTTCTTCCACACTCCCATGCTGG + Intronic
1076074933 10:127526021-127526043 CGTCTCCCCAACTGGAATGGGGG - Intergenic
1079526952 11:21402120-21402142 CTTCTTGACAACTGCAAGGACGG - Intronic
1090474189 11:127004565-127004587 CATCTTCCCCACTGCCATGCTGG + Intergenic
1090667670 11:128925511-128925533 CCTCTTCCCAGCTCCAATCCTGG + Intergenic
1090930464 11:131293614-131293636 ATGCTTCCTAACTGGAATGCAGG - Intergenic
1091526522 12:1306971-1306993 CTTCTTCCCAGCTGGCATCCTGG + Intronic
1092932502 12:13329625-13329647 CTTCTCCCCTACTTAAATGCTGG - Intergenic
1095877135 12:47091799-47091821 CCTTTTCCCTACTGCATTGCAGG + Intronic
1099262066 12:80396034-80396056 ATTCTTTCCTACTGCATTGCAGG + Intergenic
1100293904 12:93242925-93242947 CTTCTCCCCAAAGGGAATGCTGG + Intergenic
1104666571 12:130651394-130651416 GTTCTTCCCATGTGCAAGGCAGG + Intronic
1104724989 12:131070474-131070496 CTCCTACCCACCTGCAAAGCCGG - Intronic
1104802063 12:131560689-131560711 CTCCTACCCACCTGCAAAGCCGG + Intergenic
1105020794 12:132815474-132815496 CTACTTCTCAACTTAAATGCTGG + Intronic
1105467809 13:20662620-20662642 CTTCAATACAACTGCAATGCAGG - Intronic
1106654386 13:31726612-31726634 CTCATTCCCCACTGAAATGCTGG - Intergenic
1106862220 13:33921990-33922012 CTTCTTCCCATCTGTCAGGCAGG + Intronic
1107438937 13:40406814-40406836 CTTGTTCTCAACTTGAATGCTGG - Intergenic
1108603981 13:52019070-52019092 TTTCATCCATACTGCAATGCTGG + Exonic
1108979417 13:56491904-56491926 TTACTTCCCATCTGCAATGAGGG + Intergenic
1112917478 13:104569370-104569392 CTTCTTCCTAACTGTAATGTGGG + Intergenic
1114261150 14:21037226-21037248 CGGCTTCCCAACTGCAATCCTGG + Intronic
1116722597 14:48518884-48518906 CTTCTTCCCAAATGCAATATTGG - Intergenic
1118959772 14:70518411-70518433 CTTCTTGCCTACTGCAACTCCGG + Intergenic
1121113735 14:91329644-91329666 CTGCTTAGCAACTGCCATGCTGG + Intronic
1122226158 14:100281361-100281383 CTTCCTCCCAGCTGCTCTGCTGG + Exonic
1122452827 14:101824880-101824902 CATCTTCCCAACTGCATCCCAGG - Intronic
1123914014 15:25002871-25002893 CTTCTGTCCAACTGCAAGGTAGG + Intergenic
1125512393 15:40299052-40299074 CCTCCTCCCACCTGCCATGCCGG - Intronic
1125591503 15:40857213-40857235 CTTCCTCCAAACTCCTATGCAGG - Exonic
1128230885 15:66034164-66034186 CTACTTCCAAAATGCAATGGTGG - Intronic
1128649913 15:69402958-69402980 CTTCCTCCCCAATGCCATGCTGG - Intronic
1131417549 15:92273699-92273721 CTTCCTACCAACTGCATTGAAGG + Intergenic
1131677882 15:94689731-94689753 CTTCTACCCAGCAGAAATGCTGG - Intergenic
1133600211 16:7332904-7332926 CTTCTTCCGAACTACAAAGCTGG - Exonic
1134283532 16:12839354-12839376 CTGCTTCCAAAATGCAATGATGG - Intergenic
1136863746 16:33723095-33723117 CTTCTTCCCAATCTCAATGTGGG + Intergenic
1136863886 16:33725012-33725034 CTTCTTCCCAATTTCAACGTGGG + Intergenic
1136865023 16:33741556-33741578 CTTCTTCCCAATTTCAATGTAGG + Intergenic
1136865155 16:33743431-33743453 CTTCTTCCCAATTTCAATGTAGG + Intergenic
1138074375 16:54026329-54026351 CTTCTTCCTACCTGTAATGTAGG - Intronic
1138627732 16:58265947-58265969 CTTCCTCCCACCTGAATTGCTGG + Intronic
1139726888 16:68907431-68907453 CATCTTCATCACTGCAATGCAGG - Exonic
1140508018 16:75486559-75486581 CATCTGCTCAACTGCAATTCTGG + Intronic
1141396295 16:83708075-83708097 GTTCTTCCCATCAGCACTGCTGG - Intronic
1141569522 16:84925719-84925741 CTTCTTCAAACCTGCATTGCAGG - Intergenic
1203125230 16_KI270728v1_random:1571242-1571264 CTTCTTCCCAATCTCAATGTGGG + Intergenic
1203125372 16_KI270728v1_random:1573150-1573172 CTTCTTCCCAATTTCAACGTGGG + Intergenic
1203126521 16_KI270728v1_random:1589699-1589721 CTTCTTCCCAATTTCAATGTAGG + Intergenic
1146096359 17:29933598-29933620 ACTCTTCCCACCTGCGATGCTGG + Intronic
1148348063 17:46917296-46917318 CTTTTTCCAAACTACAATGGTGG + Intergenic
1150237794 17:63607061-63607083 CTTCCTCCCAACTGCAATCAGGG + Intronic
1154295726 18:13145581-13145603 TTTATTCCCAGCAGCAATGCAGG - Intergenic
1156468642 18:37363700-37363722 CTTCTTCATAACTGGGATGCAGG + Intronic
1156494891 18:37519223-37519245 CTTCTTCCCAGCTGCTGTTCTGG - Intronic
1157440057 18:47703947-47703969 CTGCTTCCCATCTGGAATCCTGG - Intergenic
1165991857 19:39819902-39819924 CATCTTGCCCACTGGAATGCAGG + Intergenic
1166711796 19:44942342-44942364 CTTCTTCTCACCCCCAATGCAGG - Exonic
1167727019 19:51222686-51222708 TTTCTTCCCACCTTCTATGCTGG - Intergenic
925802808 2:7618185-7618207 CTTCCTCCCAACAGCAAAGAAGG - Intergenic
925830075 2:7885087-7885109 CTTCTTCCGTGCTGCAATGCAGG - Intergenic
927725754 2:25421463-25421485 TTGCTTCCTAACTGCAAAGCAGG - Intronic
928894133 2:36241401-36241423 CCTCTTCCCAACTGTACTGCAGG + Intergenic
929541950 2:42829386-42829408 CTGCTGCCCCACTGCAATGCTGG - Intergenic
932185622 2:69693198-69693220 GTTCTTCCGAACTGCATTGCAGG - Intronic
932570508 2:72935997-72936019 GTTCTTCCCACCTGGAATGTCGG + Intronic
934115188 2:88783128-88783150 CTTCTTCCCAATTTCAATGTAGG - Intergenic
934628269 2:95883950-95883972 CTTCTTCCCAATTTCAATGTGGG + Intronic
934628391 2:95885825-95885847 CTTCTTCCCAATTTCAATGTAGG + Intronic
934628516 2:95887701-95887723 CTTCTTCCCAATTTCGATGTGGG + Intronic
934628776 2:95891442-95891464 CTTCTTCCCACTTTCAATGGGGG + Intronic
934628903 2:95893310-95893332 CTTCTTTCCAACTTCAATGTGGG + Intronic
934629033 2:95895179-95895201 CTTCCTCCCAATTGCAATGTGGG + Intronic
934629178 2:95897047-95897069 CTTCTTCCCAATTTCAATATGGG + Intronic
934629311 2:95898922-95898944 CTTCTTCCCAACTTCAATGTGGG + Intronic
934629447 2:95900795-95900817 CTTCCTCCCAATTGCAATGTGGG + Intronic
934629594 2:95902663-95902685 CTTCTTCCCAATTTCAATATGGG + Intronic
934629726 2:95904538-95904560 CTTCTTCCCAACTTCAATGTGGG + Intronic
934629862 2:95906411-95906433 CTTCCTCCCAATTGCAATGTGGG + Intronic
934630006 2:95908279-95908301 CTTCTTCCCAATTTCAATATGGG + Intronic
934630137 2:95910150-95910172 CTTCTTCCCAACTTCAATGTGGG + Intronic
934630267 2:95912024-95912046 CTTCCTCCCAATTGCAATGTGGG + Intronic
934630411 2:95913885-95913907 CTTCTTCCCAGTTTCAATGTGGG + Intronic
934630544 2:95915760-95915782 CTTCCTCCCAATTGCAATGTGGG + Intronic
934630683 2:95917619-95917641 CTTCTTCCCAATTTCAACGTGGG + Intronic
934630827 2:95919497-95919519 CTTCTTCCCAATTTCAATGTGGG + Intronic
934630962 2:95921371-95921393 CTTCTTCCCAATTTCAACGTGGG + Intronic
934631087 2:95923271-95923293 CTTCTTCCCAATTTCAATGTGGG + Intronic
934631340 2:95926999-95927021 ATTCTTCCCAATTTCAATGTGGG + Intronic
934631461 2:95928847-95928869 CTTCTTCCCAATTTCAATGTAGG + Intronic
934633540 2:95958366-95958388 CTTCTTCCCAATTTCAATGTAGG + Intronic
934633667 2:95960248-95960270 CTTCTTCCCAATTTCAGTGTAGG + Intronic
934799961 2:97144912-97144934 CTTCTTCCCAATTTCAATGTAGG - Intronic
934802572 2:97180136-97180158 TTTCTTCCCAATTTCAATGTAGG - Intronic
934802697 2:97181985-97182007 CTTCTTCCCAATTTCAATGTGGG - Intronic
934802958 2:97185712-97185734 CTTCTTCCCAATTTCAATGTGGG - Intronic
934803088 2:97187615-97187637 CTTCTTCCCAATTTCAATGTGGG - Intronic
934803226 2:97189503-97189525 CTTCTTCCCAATTTCAATGTGGG - Intronic
934803497 2:97193254-97193276 CTTCTTCCCAATTTCAATGTGGG - Intronic
934803647 2:97195115-97195137 CTTCCTCCCAATTGTAATGTGGG - Intronic
934803924 2:97198859-97198881 CTTCTTCCCAATTTCAATGTGGG - Intronic
934804066 2:97200723-97200745 CTTCCTCCCAATTGTAATGTGGG - Intronic
934804205 2:97202594-97202616 ATTCTTCCCAACTTCAATGTGGG - Intronic
934804340 2:97204464-97204486 CTTCTTCCCAATTTCAATGTGGG - Intronic
934804481 2:97206336-97206358 CTTCTTCCCAACTTCAACGTGGG - Intronic
934804615 2:97208207-97208229 CTTCTTCCCAATTTCAATGTGGG - Intronic
934804753 2:97210073-97210095 CTTCTTCCCAATTTCAATGTGGG - Intronic
934805011 2:97213816-97213838 CTTCTTCCCAATTTCAATGTGGG - Intronic
934805134 2:97215698-97215720 CTTCTTCCCAATTTCAATGTAGG - Intronic
934832225 2:97539809-97539831 CTTCTTCCCAATTTCAATGTGGG + Intronic
934832472 2:97543564-97543586 CTTCTTCCCAATTTCAATGTGGG + Intronic
934832721 2:97547313-97547335 CTTCTTCCCAATTTCAATGTGGG + Intronic
934832855 2:97549184-97549206 CTTCTTCCCAACTTCAATGTGGG + Intronic
934832979 2:97551069-97551091 CTTCCTCCCAGTTGCAATGTGGG + Intronic
934833118 2:97552933-97552955 CTTCTTCCCAATTTCAATGTGGG + Intronic
934833242 2:97554835-97554857 CTTCTTCCCAATTTCAATGTGGG + Intronic
935933529 2:108155821-108155843 CTCCTTACTCACTGCAATGCTGG + Intergenic
936232950 2:110720190-110720212 CTTCCTCCCAGGTGCAAGGCAGG - Intergenic
937078441 2:119123925-119123947 CTTCTTCCCACCTCCAACCCAGG - Intergenic
938273364 2:129994069-129994091 CATCTTCCCGCCTGCAATGCAGG - Intergenic
938442854 2:131352032-131352054 CATCTTCCCGCCTGCAATGCCGG + Intronic
938939001 2:136152810-136152832 CTTCCTTCCAACTGCAGTTCTGG + Intergenic
939758733 2:146147708-146147730 CTTCTACCCAACTAAAATGGTGG - Intergenic
939980964 2:148780583-148780605 TTTCTTCCCAACTACATTCCAGG + Intronic
942507024 2:176653964-176653986 CTTCTTACCAACTAAAGTGCAGG + Intergenic
944133314 2:196370428-196370450 CTTCTCCTCAAGTGGAATGCAGG + Intronic
946080294 2:217112866-217112888 CCTCTTACCTCCTGCAATGCTGG + Intergenic
946863952 2:224025943-224025965 CTTCTTGCCAACCGCAGAGCTGG + Intronic
946961836 2:224993574-224993596 ATTCTTCTCATCTGAAATGCTGG - Intronic
948797212 2:240411323-240411345 CTCCTTCGCACCTGCCATGCTGG - Intergenic
1169719682 20:8661022-8661044 CTTCTTTCCAAATGCTTTGCAGG - Intronic
1169905054 20:10594288-10594310 CTTCTCCCAAACTACAAGGCAGG - Intronic
1170355098 20:15483628-15483650 CTTCTTTCCAACTGAAAAGTTGG + Intronic
1172021038 20:31914107-31914129 CTATTTCCAAACTGCAAGGCAGG + Intronic
1173368775 20:42415545-42415567 ATTCTTCCCCACTACCATGCAGG - Intronic
1173892159 20:46521036-46521058 CCCCTTCCCTCCTGCAATGCTGG - Intergenic
1175105820 20:56614168-56614190 CATCTTCCCTACAGCAATGCAGG - Intergenic
1175910293 20:62402092-62402114 CTTCTTCCCAAGTCAGATGCAGG - Intronic
1178901317 21:36601240-36601262 CTTCCTCCCAACAGCACGGCTGG + Intergenic
1180017811 21:45098588-45098610 CCTCTTCCTAGCTGCAGTGCTGG + Intronic
1182737814 22:32543576-32543598 CTTCCTCCCAGCTGCAGTGGCGG + Intronic
1183131247 22:35838911-35838933 CTCCTTCCAAACAGCACTGCAGG + Intronic
1183333798 22:37235373-37235395 CTTCCTCCCCACTGCCAGGCTGG + Intronic
1183489073 22:38107262-38107284 CTGCTTCCCAACTGGACGGCAGG + Intronic
1183675295 22:39295889-39295911 CCTCTCCCCAACCCCAATGCAGG + Intergenic
950218212 3:11174826-11174848 CTTCTTCTCACCAGCACTGCTGG - Intronic
954636619 3:52074382-52074404 CTTCTTCCCATCGACAGTGCAGG + Intergenic
954992155 3:54850764-54850786 CTTCTGGCCAATTTCAATGCAGG - Intronic
955888596 3:63626533-63626555 TTTCTTCCAAAATGCACTGCAGG + Intergenic
956890721 3:73611441-73611463 TTTCTTGCCAGATGCAATGCTGG + Intronic
957790710 3:84937358-84937380 CTGCTTCCAAAATGCAATGGTGG - Intergenic
960044932 3:113187410-113187432 CTTCTAACCACCTCCAATGCTGG + Intergenic
961522152 3:127473103-127473125 CTGCTTCATAACTGCAGTGCTGG - Intergenic
961639509 3:128356305-128356327 TTTCTTGGCCACTGCAATGCTGG + Intronic
961829835 3:129617813-129617835 CTTTTTCCCATCTGCAAGTCTGG + Intergenic
964655902 3:159065941-159065963 CTACTTCCAAACTACAATGGTGG - Intronic
965639051 3:170813659-170813681 CATCTTCCCTACTGAAATGCTGG - Intronic
967661979 3:192123345-192123367 CTACTAACCAACTGCAACGCTGG - Intergenic
968669716 4:1842599-1842621 CTTTCTCCCAACTGGAATGTAGG + Intronic
969848914 4:9941735-9941757 CATCTTCCCAACAGCCTTGCTGG - Intronic
971328561 4:25664035-25664057 CTGCTTCCCATCTGTAAGGCTGG + Intronic
971473688 4:27052787-27052809 GTTCCTCCCAACTCTAATGCCGG + Intergenic
974116971 4:57590794-57590816 CTTCTTCCAAAATGCAATAATGG - Intergenic
976954047 4:90872267-90872289 CTTCTTCCCACCTTCTATCCTGG + Intronic
977130168 4:93226335-93226357 CTACTTCCAAAATGCAATGGTGG + Intronic
977338012 4:95722116-95722138 CCCCTACCCAACTGCAAAGCAGG + Intergenic
978103045 4:104866742-104866764 CTTCTTTCAAAATGCAAGGCAGG + Intergenic
980300324 4:130982997-130983019 CTTCGTCACAACGGCTATGCTGG - Intergenic
982268133 4:153559178-153559200 CTTCTCCCCAACTGGAATGTAGG - Intronic
983131328 4:164023065-164023087 CTTTTTCCCAACTCAAGTGCTGG - Intronic
983238191 4:165204142-165204164 TTTCTTCCCCACTGTAATGTTGG + Intronic
984446101 4:179837633-179837655 GTTCTTTCCACCTGCACTGCCGG - Intergenic
986512357 5:8521585-8521607 CTTCTTCCCAACTGAGATCCAGG + Intergenic
987156244 5:15092321-15092343 TTTATTCCTAACTGCAATGGAGG - Intergenic
988068131 5:26250112-26250134 ATGCTTCCAAACTGCAATGTTGG + Intergenic
988316500 5:29636684-29636706 CTTCATGGCAACTGCAAAGCAGG + Intergenic
988784469 5:34553369-34553391 CATCTACCCTACTGCAATGGAGG + Intergenic
990120655 5:52446947-52446969 TATCTACCCAACTGAAATGCTGG - Intergenic
990698676 5:58451762-58451784 CTTCTACCCAACTGCATTTCTGG - Intergenic
991042343 5:62189000-62189022 CCTGTTCCCATCTGAAATGCAGG + Intergenic
994575847 5:101578627-101578649 CTTCTTCCCAAGTATAAGGCCGG + Intergenic
994592619 5:101791333-101791355 CTACTTCCAAAATGCAATGATGG + Intergenic
995447807 5:112265859-112265881 ACTCTTCACAACAGCAATGCAGG + Intronic
995602492 5:113813006-113813028 CCTATTTCCAACTGCCATGCTGG + Intergenic
995793342 5:115916958-115916980 CTTCACCCCAGCTGAAATGCAGG + Intergenic
996652737 5:125900509-125900531 CTTCTTCCTAACTGAAATGTGGG - Intergenic
997007006 5:129829500-129829522 CTTCTTCCTATCTGCAAGGGAGG - Intergenic
997964735 5:138348017-138348039 CACCTTCCCAACAGCAGTGCTGG - Exonic
998342266 5:141428443-141428465 GTTTTTCCCAACTACAATGAGGG + Intronic
1000644798 5:163748281-163748303 CTCCTTCCCAATTACAATCCAGG - Intergenic
1000717429 5:164663303-164663325 CTATTTCCCAAGTGTAATGCAGG - Intergenic
1003592072 6:7444961-7444983 CTTCTTAAAAACTGCAATACAGG + Intergenic
1004074937 6:12336490-12336512 CTTCTTCCCCACTGTATTGAGGG - Intergenic
1005882908 6:30074319-30074341 CTTCTTCCCAGCAGCCAAGCTGG - Intronic
1008068581 6:47076123-47076145 CTTTATCCCAAATGCAAAGCAGG + Intergenic
1014582546 6:123156869-123156891 CTTTTTCCCAGCTGGAATTCTGG + Intergenic
1015643348 6:135362474-135362496 CATGTTCCCACCGGCAATGCAGG + Intronic
1016798740 6:148146701-148146723 CTTCTTCCTCAATGCAAAGCAGG - Intergenic
1019641221 7:2104868-2104890 CTCCTTCCAACGTGCAATGCAGG + Intronic
1023406132 7:39834747-39834769 CGTCTTCCCGCCTGCAATGCCGG - Intergenic
1023729477 7:43176890-43176912 CTGCTTCGTAATTGCAATGCAGG - Intronic
1024414072 7:49081899-49081921 CTGCTTCCAAAATACAATGCTGG + Intergenic
1026116613 7:67501310-67501332 CTTCTTCCTGCCTGGAATGCAGG - Intergenic
1028435015 7:90793266-90793288 CTACCTCCCACCTGCAAGGCAGG - Intronic
1029454697 7:100663072-100663094 TTTGTGCCCCACTGCAATGCTGG - Intergenic
1029473481 7:100768874-100768896 CTTCTTACCAACTCCAATCTTGG - Intronic
1030165699 7:106552979-106553001 CTTCTGCAAAACTGCAATGAAGG + Intergenic
1031583089 7:123501172-123501194 CTTCTTCTCACATGGAATGCAGG + Intronic
1032274994 7:130446518-130446540 CTTCTTCCCCACTTCTATGATGG - Intergenic
1032805316 7:135348430-135348452 CTTCTTCCGAAATGAAAAGCGGG + Intergenic
1034945797 7:155260940-155260962 CTGCTTCCCAAATGCCATGGTGG - Intergenic
1035464784 7:159067735-159067757 CTTCTTTCCAACATCAGTGCTGG - Intronic
1036181754 8:6591730-6591752 CTTCTATCCAAATGCAGTGCAGG - Intronic
1039251690 8:35672527-35672549 CTTTTTCCCATCTGCAAAGAGGG - Intronic
1042470315 8:69179842-69179864 CTTTTTCCCATCTGCAAAGCAGG + Intergenic
1042701401 8:71618814-71618836 CTGCTTCCCACCTGGAATTCTGG - Intergenic
1044496898 8:92897117-92897139 CTACTTCCAAAGTACAATGCTGG - Intronic
1044712659 8:95072649-95072671 CATCTGCCCAACCTCAATGCAGG - Intronic
1047760606 8:127951277-127951299 CTTCTACCCCAGTGCACTGCTGG + Intergenic
1048971447 8:139647182-139647204 CTTCTTCCCAGTTGCCATCCTGG - Intronic
1049994450 9:1021359-1021381 CTTCTTACAAACTCCAGTGCAGG + Intergenic
1050057554 9:1671785-1671807 CTACTTCCAAAATGCAATGATGG + Intergenic
1050631503 9:7563336-7563358 CTTCTTCGCAAGTGAAATACTGG + Intergenic
1052040184 9:23729277-23729299 TTTCTTCCCAACTACAACTCAGG + Intronic
1053487508 9:38471099-38471121 CTTGTTCCCAACTCCTTTGCTGG + Intergenic
1055453870 9:76455233-76455255 CTTATTCCAAATTCCAATGCTGG + Intronic
1057625127 9:96669870-96669892 CTTAATCACAACTGCAATGTTGG + Intergenic
1057700261 9:97359089-97359111 CCTCTGCACAACTGCACTGCAGG - Intronic
1059704616 9:116809853-116809875 CTTCAGCCCAACTGCAAGACAGG - Intronic
1060477648 9:123998222-123998244 CTTCCTACCAACTGCAATCCTGG + Intergenic
1060705395 9:125793760-125793782 CATTATCCCAACTGCAATGATGG - Intronic
1061077869 9:128352793-128352815 CCTCTTCCCAACTACACTCCGGG + Intronic
1061177748 9:129007901-129007923 CTTCTTCCCAACTAGAGAGCTGG + Intronic
1061317516 9:129805588-129805610 CTTCTCACCAACTGCACTGCTGG - Intronic
1062046734 9:134427819-134427841 CTTAATCCCAACTGTAATCCTGG - Intronic
1062080037 9:134618963-134618985 GCTCTTCCCACCTGCACTGCAGG + Intergenic
1203582560 Un_KI270746v1:24919-24941 CTTCTTCCCAATTTCAATGTAGG - Intergenic
1203582831 Un_KI270746v1:28391-28413 CTTCTTCCCAATTTCAATGTGGG - Intergenic
1191869873 X:65736783-65736805 CTCCTTCCCTAGTGCTATGCTGG + Exonic
1194505959 X:94733617-94733639 GTTCTTCCAAAATGCAATGTTGG - Intergenic
1198671845 X:139089619-139089641 CTTCATCTCAACTGAAATCCTGG + Intronic
1198915669 X:141668793-141668815 TTTCTTCCCAACTGTAATCTGGG + Intronic
1199308983 X:146300525-146300547 CTTCTCCCCTCCTGCCATGCGGG + Intergenic
1201455996 Y:14167345-14167367 CTTCTTCCCAACAGCAGTTGAGG + Intergenic
1202586834 Y:26439206-26439228 CTTCTTCCCAATTTCAATGCAGG - Intergenic