ID: 1071323898

View in Genome Browser
Species Human (GRCh38)
Location 10:84492505-84492527
Sequence TTGAATAAGAATTATGAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071323897_1071323898 1 Left 1071323897 10:84492481-84492503 CCAGCTTGGATTTTCATTACTAT 0: 1
1: 0
2: 5
3: 43
4: 372
Right 1071323898 10:84492505-84492527 TTGAATAAGAATTATGAGAATGG No data
1071323895_1071323898 20 Left 1071323895 10:84492462-84492484 CCTTCTTTGCATTATGTCACCAG 0: 1
1: 0
2: 1
3: 32
4: 1276
Right 1071323898 10:84492505-84492527 TTGAATAAGAATTATGAGAATGG No data
1071323894_1071323898 21 Left 1071323894 10:84492461-84492483 CCCTTCTTTGCATTATGTCACCA 0: 1
1: 0
2: 0
3: 15
4: 294
Right 1071323898 10:84492505-84492527 TTGAATAAGAATTATGAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071323898 Original CRISPR TTGAATAAGAATTATGAGAA TGG Intronic
No off target data available for this crispr